AMCG00017939 (bnc2,LOC106933596)


Basic Information

Item Value
gene id AMCG00017939
gene name bnc2,LOC106933596
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030131.1
NCBI id CM030131.1
chromosome length 33043351
location 29577109 ~ 29584432 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00017939
ATGCACAAACACACCCCGCATTCCTGCACCGCTGGGTCCCGCGAGAAGCAGCGTTTCCCCCGCGAAATGAGCTCCACGGGCTGGCAGGGGGCCATACGCTGCACCCTGGTGAACTGCACGTGTGAGTGTTTCCAGCCTGGCAAGATCAACCTGAGGACATGTGACCAGTGTAAGCACGGCTGGGTGGCACATGCGCTGGACAAGCTGAGCACGCAGCACCTGTACCACCCCACGCAGGTGGAGATCGTGCAGTCCAACGTGGTGTTCGACATCAGCAGCCTCATGCTGTACGGCACGCAGGCCGTGCCCGTGCGCCTCAAGATCCTGCTGGACCGGCTCTTCAGCGTTCTGAAGCAGGAGGAGGTGCTGCACATCCTGCACGGCCTGGGCTGGACGCTGCGCGACTACGTCCGGGGATACATCCTGCAGGTGAGTGGCCCGTGGGCTCCGGACACAATGGGACACGAGCCCTAG

Function

symbol description
bnc2 Predicted to enable transcription cis-regulatory region binding activity. Acts upstream of or within developmental pigmentation and pronephric nephron tubule development. Located in nucleus. Is expressed in several structures, including centrum; gut; hypodermal cell; nervous system; and pleuroperitoneal region. Used to study urinary tract obstruction. Orthologous to human BNC2 (basonuclin 2).

NR:

description
zinc finger protein basonuclin-2 isoform X3

GO:

id name namespace
GO:0048066 developmental pigmentation biological_process
GO:0005634 nucleus cellular_component
GO:0046872 metal ion binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00017939 True 474 mRNA 0.63 3 29577109 29584432

Neighbor

gene id symbol gene type direction distance location
AMCG00017937 bnc2,LOC107737408,LOC107737409,LOC107678088 coding downstream 32204 29538155 ~ 29544905 (-)
AMCG00017938 NA coding downstream 49612 29525435 ~ 29527497 (-)
AMCG00017934 psip1 coding downstream 211561 29355039 ~ 29365548 (-)
AMCG00017932 ttc39b,LOC106578215 coding downstream 244630 29307083 ~ 29332479 (-)
AMCG00017935 NA coding downstream 272305 29288829 ~ 29304804 (-)
AMCG00017947 NA coding upstream 381067 29965499 ~ 29966626 (-)
AMCG00017944 trmo coding upstream 386658 29971090 ~ 29975805 (-)
AMCG00017945 NA coding upstream 392312 29976744 ~ 29983256 (-)
AMCG00017949 NA coding upstream 426878 30011310 ~ 30030524 (-)
AMCG00017955 NA coding upstream 527858 30112290 ~ 30112964 (-)
G94246 NA non-coding downstream 290362 29286207 ~ 29286747 (-)
G94218 NA non-coding downstream 369305 29207470 ~ 29207804 (-)
G94137 NA non-coding downstream 841365 28733824 ~ 28735744 (-)
G94074 NA non-coding downstream 1151866 28425032 ~ 28425243 (-)
G94073 NA non-coding downstream 1156847 28419916 ~ 28420262 (-)
G94337 NA non-coding upstream 327550 29911982 ~ 29914837 (-)
G94358 NA non-coding upstream 411817 29996249 ~ 29997513 (-)
G94359 NA non-coding upstream 413922 29998354 ~ 30002282 (-)
G94392 NA non-coding upstream 524539 30108971 ~ 30109182 (-)
G94483 NA non-coding upstream 871766 30456198 ~ 30461173 (-)
G94238 pla2g12a,LOC108263807,LOC102792247 other downstream 303941 29269235 ~ 29273168 (-)
G94172 NA other downstream 701186 28874161 ~ 28875923 (-)
AMCG00017906 elavl2 other downstream 1432520 28098905 ~ 28144589 (-)
AMCG00017902 NA other downstream 1737319 27838251 ~ 27839790 (-)
G93796 NA other downstream 3467035 26109060 ~ 26110074 (-)
AMCG00017972 dcaf10 other upstream 1001297 30585729 ~ 30596417 (-)
G94543 NA other upstream 1043556 30627988 ~ 30658493 (-)
AMCG00018000 slc1a1 other upstream 2675275 32259707 ~ 32263865 (-)
AMCG00018004 NA other upstream 2687262 32271694 ~ 32276372 (-)
AMCG00018007 NA other upstream 2701053 32285485 ~ 32308080 (-)

Expression


Co-expression Network