AMCG00018000 (slc1a1)


Basic Information

Item Value
gene id AMCG00018000
gene name slc1a1
gene type misc
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030131.1
NCBI id CM030131.1
chromosome length 33043351
location 32259707 ~ 32263865 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018000
ATGAGTACAAGGCTGGCAGTTAACCCACAAATTCCTACTGTGGCCCTCAGACTGGCTATTCATACTCTTATCGTCCTCCCATTGTTGTACTTCATCTTCGTGAGGAAGAACCCGTACAAGTTTGCGCTGGGGATGTCCCAGGCGATGGTCACCGCTCTGATGATCTCCTCCAGCTCGGCTACGTTGCCAGTGACCATTCGATGCGCAGAGCAGAACAACAGAATTGACAAGAGGATCACACAGTTCATGTTGCCAATCGGCGCCACCATCAACATGGACGGCTCTGCCCTCTATGAGGCCGTGGCGGCCGTCTTCATTGCACAGCTGGGCAACTATGCGCTGGACATTGGCCAGATCGTGACCATCAGGGTGAAGGTCTCATGGATGGAGAATCACAGTTGGCAGCACCTGCCCGGCCCAACTAATGCCAAACATGGGCCACCACTCGCGGGTGGAACCGCCAGTTTGAAGACAGAGGTCTAG
>TU118224
GACTGGCTATTCATACTCTTATCGTCCTCCCATTGTTGTACTTCATCTTCGTGAGGAAGAACCCGTACAAGTTTGCGCTGGGGATGTCCCAGGCGATGGTCACCGCTCTGATGATCTCCTCCAGCTCGGCTACGTTGCCAGTGACCATTCGATGCGCAGAGCAGAACAACAGAATTGACAAGAGGATCACACAGTTCATGTTGCCAATCGGCGCCACCATCAACATGGACGGCTCTGCCCTCTATGAGGCCGTGGCGGCCGTCTTCATTGCACAGCTGGGCAACTATGCGCTGGACATTGGCCAGATCGTGACCATCAGGTGAGTCCCTGAAGTCTCCC

Function

symbol description
slc1a1 Predicted to enable symporter activity. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in cerebellum; optic tectum; and telencephalon. Human ortholog(s) of this gene implicated in dicarboxylic aminoaciduria and schizophrenia 18. Orthologous to human SLC1A1 (solute carrier family 1 member 1).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018000 True 483 mRNA 0.54 4 32259707 32263865
TU118224 False 339 TUCP 0.55 2 32262776 32263531

Neighbor

gene id symbol gene type direction distance location
AMCG00017998 NA coding downstream 11529 32233851 ~ 32248178 (-)
AMCG00017999 zgc:136353 coding downstream 48741 32199753 ~ 32210966 (-)
AMCG00017994 NA coding downstream 85845 32164063 ~ 32173862 (-)
AMCG00017993 sepsecs coding downstream 95726 32155771 ~ 32163981 (-)
AMCG00017990 NA coding downstream 108031 32143816 ~ 32151676 (-)
AMCG00018006 LOC108437089,LOC103038323,LOC107561515,LOC107738333,LOC107691852 coding upstream 83630 32347495 ~ 32360816 (-)
AMCG00018009 NA coding upstream 116647 32380512 ~ 32381489 (-)
AMCG00018008 NA coding upstream 117685 32381550 ~ 32387686 (-)
AMCG00018015 NA coding upstream 161160 32425025 ~ 32429565 (-)
AMCG00018016 NA coding upstream 197729 32461594 ~ 32478852 (-)
G94747 NA non-coding downstream 63101 32192183 ~ 32196606 (-)
G94665 NA non-coding downstream 430907 31828459 ~ 31828800 (-)
G94655 LOC100709447,LOC101481844,LOC102214071,LOC102780160,LOC106514855,LOC108234835 non-coding downstream 518048 31741224 ~ 31741659 (-)
G94622 NA non-coding downstream 637329 31621600 ~ 31622378 (-)
G94600 NA non-coding downstream 742671 31516832 ~ 31517036 (-)
G94791 NA non-coding upstream 81385 32345250 ~ 32346583 (-)
G94927 NA non-coding upstream 525914 32789779 ~ 32790688 (-)
G94936 NA non-coding upstream 584401 32848266 ~ 32848466 (-)
G94543 NA other downstream 1601214 30627988 ~ 30658493 (-)
AMCG00017972 dcaf10 other downstream 1663290 30585729 ~ 30596417 (-)
G94238 pla2g12a,LOC108263807,LOC102792247 other downstream 2986539 29269235 ~ 29273168 (-)
G94172 NA other downstream 3383784 28874161 ~ 28875923 (-)
AMCG00017906 elavl2 other downstream 4115118 28098905 ~ 28144589 (-)
AMCG00018004 NA other upstream 7829 32271694 ~ 32276372 (-)
AMCG00018007 NA other upstream 21620 32285485 ~ 32308080 (-)
G94835 NA other upstream 191220 32455085 ~ 32456410 (-)
AMCG00018021 ank2,LOC106577504,LOC106608576 other upstream 337324 32601189 ~ 32605751 (-)
G94887 NA other upstream 384599 32648464 ~ 32652684 (-)

Expression


Co-expression Network