G90703


Basic Information

Item Value
gene id G90703
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030131.1
NCBI id CM030131.1
chromosome length 33043351
location 6283157 ~ 6283441 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU113092
ttttgccgccaaaacagccctgacccgtcgaggcatggactccactagacctctgaaggtgtgctgtggtatctggcaccaagacgttagcagcagatcctttaagtcctgtgagttgcgaggtggggcctccatggatcggacttgtttgtccagcacatcccacagatgctcgatttgattgagatctggggaatttggaggccaagtcaacaccttgaactcatgattcatcagaccaggccaccttcttccattgctccgtggtccagttctgatgctcac

Function

GO: NA

KEGG:

id description
ko04913 Ovarian steroidogenesis
ko04927 Cortisol synthesis and secretion

RNA

RNA id representative length rna type GC content exon number start site end site
TU113092 True 285 lncRNA 0.53 1 6283157 6283441

Neighbor

gene id symbol gene type direction distance location
AMCG00017480 NA coding upstream 331365 5950836 ~ 5951792 (+)
AMCG00017475 NA coding upstream 466159 5808828 ~ 5816998 (+)
AMCG00017474 fgf2,LOC106604591,LOC102794353 coding upstream 490652 5779880 ~ 5792505 (+)
AMCG00017471 NA coding upstream 642915 5625024 ~ 5640242 (+)
AMCG00017470 kiaa1109 coding upstream 659003 5538512 ~ 5624154 (+)
AMCG00017477 fat4 coding downstream 29341 6312782 ~ 6317887 (+)
AMCG00017479 fat4,LOC106604622,LOC102795788 coding downstream 77918 6361359 ~ 6370652 (+)
AMCG00017478 LOC106611628 coding downstream 98918 6382359 ~ 6400405 (+)
AMCG00017484 NA coding downstream 561118 6844559 ~ 6844962 (+)
AMCG00017483 NA coding downstream 561534 6844975 ~ 6846106 (+)
G90691 NA non-coding upstream 304789 5978164 ~ 5978368 (+)
G90647 NA non-coding upstream 605913 5676901 ~ 5677244 (+)
G90561 NA non-coding upstream 820093 5440212 ~ 5463064 (+)
G90552 NA non-coding upstream 870468 5407648 ~ 5412689 (+)
G90554 NA non-coding upstream 870896 5411731 ~ 5412261 (+)
G90709 NA non-coding downstream 118293 6401734 ~ 6402188 (+)
G90731 NA non-coding downstream 444591 6728032 ~ 6763072 (+)
G90737 NA non-coding downstream 591526 6874967 ~ 6892610 (+)
G90738 NA non-coding downstream 600213 6883654 ~ 6883957 (+)
G90733 NA non-coding downstream 691220 6974661 ~ 7011061 (+)
AMCG00017446 NA other upstream 1594934 4662625 ~ 4688223 (+)
AMCG00017445 NA other upstream 1676586 4592802 ~ 4606571 (+)
AMCG00017422 leprotl1,LOC103152176 other upstream 3587704 2687420 ~ 2695453 (+)
AMCG00017388 LOC108267694,LOC106608525 other upstream 6071221 207586 ~ 211936 (+)
AMCG00017386 dctn1,LOC101464740 other upstream 6184760 48007 ~ 98397 (+)
AMCG00017486 NA other downstream 446297 6729738 ~ 7188643 (+)
G90877 NA other downstream 1384742 7668183 ~ 7671850 (+)
G90881 NA other downstream 1409144 7692585 ~ 7693347 (+)
AMCG00017508 NA other downstream 1522937 7806378 ~ 7813639 (+)
G90955 NA other downstream 1848927 8132368 ~ 8132854 (+)

Expression


Co-expression Network