G92169


Basic Information

Item Value
gene id G92169
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030131.1
NCBI id CM030131.1
chromosome length 33043351
location 16841453 ~ 16909914 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU114959
gaaggtgtgctgtggtatctggcaccaagacgttagcagcagatcctttaagtcctgtaagttgcgaggtggggatcggacttgtttgtccagcacatcccacagatgctcgattggattgagatctggggaatttggaggccaagtcaacaccttgaactcgtgattcatcagaccaggccaccttcttccattgctct

Function

NR:

description
PREDICTED: lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex, mitochondrial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU114959 True 200 lncRNA 0.51 2 16841453 16909914

Neighbor

gene id symbol gene type direction distance location
AMCG00017656 NA coding upstream 1006403 15828929 ~ 15835050 (+)
AMCG00017658 NA coding upstream 1047006 15609983 ~ 15794447 (+)
AMCG00017657 slc7a11,LOC107740166,LOC107593222,LOC107680987 coding upstream 1236343 15599419 ~ 15605110 (+)
AMCG00017654 NA coding upstream 1629194 15207609 ~ 15212259 (+)
AMCG00017655 NA coding upstream 1647289 15193702 ~ 15194164 (+)
AMCG00017662 NA coding downstream 485817 17395731 ~ 17428335 (+)
AMCG00017666 pgrmc2 coding downstream 599337 17509251 ~ 17511291 (+)
AMCG00017667 mfsd8 coding downstream 668141 17578055 ~ 17585825 (+)
AMCG00017673 NA coding downstream 766695 17676609 ~ 17692389 (+)
AMCG00017679 reep1,LOC107719410,LOC107731967,LOC107703485,LOC107561684 coding downstream 844611 17754525 ~ 17782183 (+)
G92152 NA non-coding upstream 177218 16663866 ~ 16664235 (+)
G92151 NA non-coding upstream 237534 16603651 ~ 16603919 (+)
G92147 LOC102215562 non-coding upstream 410741 16430452 ~ 16430712 (+)
G92145 NA non-coding upstream 525930 16315054 ~ 16315523 (+)
G92133 NA non-coding upstream 659383 16166642 ~ 16182070 (+)
G92178 NA non-coding downstream 87304 16997218 ~ 16997459 (+)
G92182 NA non-coding downstream 251331 17161245 ~ 17161645 (+)
G92197 NA non-coding downstream 331902 17241816 ~ 17242064 (+)
G92228 NA non-coding downstream 529746 17439660 ~ 17440209 (+)
G92229 jade1,LOC107712027 non-coding downstream 530744 17440658 ~ 17440964 (+)
G92130 LOC101154678 other upstream 706137 16135025 ~ 16135316 (+)
G92123 LOC101154678 other upstream 973819 15867031 ~ 15867634 (+)
AMCG00017650 NA other upstream 1725422 15109422 ~ 15116031 (+)
AMCG00017652 NA other upstream 1734618 15093191 ~ 15106835 (+)
AMCG00017651 NA other upstream 1750624 15088132 ~ 15090829 (+)
AMCG00017668 NA other downstream 691621 17601535 ~ 17620033 (+)
AMCG00017674 rnf103,LOC107722440 other downstream 789009 17698923 ~ 17723950 (+)
G92538 NA other downstream 2163324 19073238 ~ 19073662 (+)
AMCG00017710 nans,LOC108241509,LOC103384124,LOC107390934,LOC107390917 other downstream 2486114 19396028 ~ 19433103 (+)
AMCG00017712 NA other downstream 2534258 19444172 ~ 19528293 (+)

Expression


Co-expression Network