G94073



Basic Information


Item Value
gene id G94073
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030131.1
NCBI id CM030131.1
chromosome length 33043351
location 28419916 ~ 28420262 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU117353
agaggcagttcagaggggagcaaccagacttattccaggtctgaagggaacgtcctactgagagactgaggaactgaaccttttcaccctggaacagaggagactacgtggggacttgatccaagtcttcaaaatcatgaaaggcatggaccacatcaaaccagaggagcttttccagatcagcagggacacacgcacccggggacacaaatggaaattgggcttcaaggcattcaagacagaaaacaggagacacttcttcacacagagaggcgtcacaatctgaacaaactccccagcgatgtggctgaagagacaatttgggaacattcaaaaacagactggat

Function


NR:

description
PREDICTED: regulator of G-protein signaling 5

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU117353 True 347 lncRNA 0.49 1 28419916 28420262

Neighbor


gene id symbol gene type direction distance location
AMCG00017903 NA coding downstream 575145 27842212 ~ 27844771 (-)
AMCG00017899 NA coding downstream 696185 27698901 ~ 27723731 (-)
AMCG00017895 NA coding downstream 987340 27427479 ~ 27432576 (-)
AMCG00017893 NA coding downstream 993684 27415574 ~ 27426232 (-)
AMCG00017894 NA coding downstream 1011359 27400504 ~ 27408557 (-)
AMCG00017907 NA coding upstream 13770 28434032 ~ 28443288 (-)
AMCG00017908 NA coding upstream 37434 28457696 ~ 28457938 (-)
AMCG00017909 cxxc4,LOC103148507,LOC106610359 coding upstream 148698 28568960 ~ 28569655 (-)
AMCG00017911 NA coding upstream 229679 28649941 ~ 28664695 (-)
AMCG00017916 NA coding upstream 274286 28694548 ~ 28698519 (-)
G94060 NA non-coding downstream 322758 28093468 ~ 28097158 (-)
G94012 NA non-coding downstream 635866 27779037 ~ 27784050 (-)
G94008 NA non-coding downstream 652585 27762686 ~ 27767331 (-)
G93843 NA non-coding downstream 1920739 26498914 ~ 26499177 (-)
G93816 NA non-coding downstream 2066192 26353517 ~ 26353724 (-)
G94074 NA non-coding upstream 4770 28425032 ~ 28425243 (-)
G94137 NA non-coding upstream 313562 28733824 ~ 28735744 (-)
G94218 NA non-coding upstream 787208 29207470 ~ 29207804 (-)
G94246 NA non-coding upstream 865945 29286207 ~ 29286747 (-)
G94337 NA non-coding upstream 1491720 29911982 ~ 29914837 (-)
AMCG00017906 elavl2 other downstream 275327 28098905 ~ 28144589 (-)
AMCG00017902 NA other downstream 580126 27838251 ~ 27839790 (-)
G93796 NA other downstream 2309842 26109060 ~ 26110074 (-)
G93795 shisa3,LOC102786300 other downstream 2312111 26104026 ~ 26107805 (-)
AMCG00017866 smim19,LOC107754471,LOC106604684,LOC106611785 other downstream 2403974 26012488 ~ 26015942 (-)
G94172 NA other upstream 453899 28874161 ~ 28875923 (-)
G94238 pla2g12a,LOC108263807,LOC102792247 other upstream 848973 29269235 ~ 29273168 (-)
AMCG00017972 dcaf10 other upstream 2165467 30585729 ~ 30596417 (-)
G94543 NA other upstream 2207726 30627988 ~ 30658493 (-)
AMCG00018000 slc1a1 other upstream 3839445 32259707 ~ 32263865 (-)

Expression



Co-expression Network