AMCG00018045 (gna12,LOC106593785,LOC106535814)


Basic Information

Item Value
gene id AMCG00018045
gene name gna12,LOC106593785,LOC106535814
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 429053 ~ 430631 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018045
ATGTCCGGCGTGGTGCGCACCCTGAGCCGCTGCCTGCTGCCCGCGGAAGCCAGCCGGGAGCGGAGCGGCAGCAAGGAGCGCAGCCGGGACCGGGACGCCAACCAGGAGCGGGAGGCGAGGCGCCGCAGCCGGGAGATCGACTCTATGCTGGCCCGTGAGAGGCGCTCCATCCGCCGCCTGGTCAAGATCCTGCTCCTGGGGGCCGGGGAGAGTGGGAAGTCCACTTTCCTGAAGCAGATGCGGATTATCCACGGCAAGGAGTTCGACCAGAAAGCGCTGCTGGACTTCCGAGATACCATCTTCGAGAACATCATCAAGCCGCTGTTAGGAGACCCCTGTACAAGACTAGGGATCGTGGTTTCCCAGGACTAG

Function

symbol description
gna12 Predicted to enable D5 dopamine receptor binding activity; G-protein beta/gamma-subunit complex binding activity; and GTPase activity. Involved in regulation of TOR signaling and regulation of proteasomal ubiquitin-dependent protein catabolic process. Located in focal adhesion.

NR:

description
PREDICTED: guanine nucleotide-binding protein subunit alpha-12

GO:

id name namespace
GO:0042074 cell migration involved in gastrulation biological_process
GO:0007188 adenylate cyclase-modulating G protein-coupled receptor signaling pathway biological_process
GO:0009826 unidimensional cell growth biological_process
GO:0007266 Rho protein signal transduction biological_process
GO:0032956 regulation of actin cytoskeleton organization biological_process
GO:0006184 obsolete GTP catabolic process biological_process
GO:2000048 negative regulation of cell-cell adhesion mediated by cadherin biological_process
GO:0043149 stress fiber assembly biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0031526 brush border membrane cellular_component
GO:0005834 heterotrimeric G-protein complex cellular_component
GO:0003924 GTPase activity molecular_function
GO:0005525 GTP binding molecular_function
GO:0004871 obsolete signal transducer activity molecular_function
GO:0031683 G-protein beta/gamma-subunit complex binding molecular_function
GO:0031752 D5 dopamine receptor binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018045 True 372 mRNA 0.65 2 429053 430631

Neighbor

gene id symbol gene type direction distance location
AMCG00018044 LOC107592484 coding upstream 10373 391725 ~ 418680 (+)
AMCG00018038 NA coding upstream 399367 25688 ~ 29686 (+)
AMCG00018046 gna12,gna12a,LOC107674729,LOC107753491,LOC107703403 coding downstream 9559 440190 ~ 445050 (+)
AMCG00018043 gna12,gna12a,LOC107758336,LOC107703403,LOC107674729 coding downstream 34874 465505 ~ 467994 (+)
AMCG00018051 eif3b,eif3ba coding downstream 59488 490119 ~ 499466 (+)
AMCG00018050 NA coding downstream 70911 501542 ~ 513021 (+)
AMCG00018053 NA coding downstream 82709 513340 ~ 513737 (+)
G114018 NA non-coding downstream 38157 468788 ~ 472124 (+)
G114056 NA non-coding downstream 122579 553210 ~ 553504 (+)
G114205 NA non-coding downstream 732261 1162892 ~ 1178095 (+)
G114237 NA non-coding downstream 836209 1266840 ~ 1268893 (+)
G114253 NA non-coding downstream 859924 1290555 ~ 1291851 (+)
G114053 snn,LOC107703342,LOC107564698 other downstream 144629 575260 ~ 579704 (+)
G114123 NA other downstream 346752 777383 ~ 794790 (+)
AMCG00018072 LOC107720077 other downstream 440690 871321 ~ 889033 (+)
G114219 NA other downstream 789148 1219779 ~ 1220216 (+)
G114320 adap1,LOC108228240,LOC107388258,LOC102218716 other downstream 1517210 1947841 ~ 1949593 (+)

Expression


Co-expression Network