AMCG00018046 (gna12,gna12a,LOC107674729,LOC107753491,LOC107703403)


Basic Information

Item Value
gene id AMCG00018046
gene name gna12,gna12a,LOC107674729,LOC107753491,LOC107703403
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 440190 ~ 445050 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018046
ATGCAGATCGGACCAGAGCGCCTGGTGCCAGGAGCGTTTGTGACGGCTGGCCTGCGCACGGCAGCTCTCCCTGGCGGGTCTCTGCTGGCGGGGGCTGATGGCACCACAGGCCATACAGAGCCCCCCCGTCCCCGCCGTGGGCTCCTGCCTTTACTGCATGTGACAGCAGTGCGAGTCATGTGCCTAATTAAGGGCATGCGGGTGCTGGTGGACGCCCGTGACAAGCTGGGCATCGCCTGGCAGAACACGGAGAACGAGAAGCACGGCATGTTCGTCATGGCGTTCGAGAACAAGGCTGGCGTGCCCGTGGAGCCCTGCACCTTCCAGCTGTACGTGCCGGCGCTGCGGGGGCTGTGGGCCGACTCCGGGATCCAGGAGGCATACGGGCGGCGCAGCGAGTTCCAGCTGGTGAGTCGGGAGCCCAGGGCCAGGGTGCCCAGCCTGTCCGAGCCCCTCGGAACAGCAGCTCCATTGTGTGGGACGTTCCCATTGTAG

Function

symbol description
gna12a Predicted to enable D5 dopamine receptor binding activity; G-protein beta/gamma-subunit complex binding activity; and GTPase activity. Acts upstream of or within several processes, including gastrulation; glial cell development; and negative regulation of cell-cell adhesion mediated by cadherin. Predicted to be part of heterotrimeric G-protein complex. Predicted to be active in brush border membrane. Is expressed in brain; gill; head; and olfactory epithelium. Orthologous to human GNA12 (G protein subunit alpha 12).
gna12 Predicted to enable D5 dopamine receptor binding activity; G-protein beta/gamma-subunit complex binding activity; and GTPase activity. Involved in regulation of TOR signaling and regulation of proteasomal ubiquitin-dependent protein catabolic process. Located in focal adhesion.

NR:

description
PREDICTED: guanine nucleotide-binding protein subunit alpha-12

GO:

id name namespace
GO:0042074 cell migration involved in gastrulation biological_process
GO:0007188 adenylate cyclase-modulating G protein-coupled receptor signaling pathway biological_process
GO:0009826 unidimensional cell growth biological_process
GO:0007266 Rho protein signal transduction biological_process
GO:0032956 regulation of actin cytoskeleton organization biological_process
GO:0006184 obsolete GTP catabolic process biological_process
GO:2000048 negative regulation of cell-cell adhesion mediated by cadherin biological_process
GO:0043149 stress fiber assembly biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0031526 brush border membrane cellular_component
GO:0005834 heterotrimeric G-protein complex cellular_component
GO:0003924 GTPase activity molecular_function
GO:0005525 GTP binding molecular_function
GO:0004871 obsolete signal transducer activity molecular_function
GO:0031683 G-protein beta/gamma-subunit complex binding molecular_function
GO:0031752 D5 dopamine receptor binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018046 True 495 mRNA 0.66 4 440190 445050

Neighbor

gene id symbol gene type direction distance location
AMCG00018045 gna12,LOC106593785,LOC106535814 coding upstream 9559 429053 ~ 430631 (+)
AMCG00018044 LOC107592484 coding upstream 21510 391725 ~ 418680 (+)
AMCG00018038 NA coding upstream 410504 25688 ~ 29686 (+)
AMCG00018043 gna12,gna12a,LOC107758336,LOC107703403,LOC107674729 coding downstream 20455 465505 ~ 467994 (+)
AMCG00018051 eif3b,eif3ba coding downstream 45069 490119 ~ 499466 (+)
AMCG00018050 NA coding downstream 56492 501542 ~ 513021 (+)
AMCG00018053 NA coding downstream 68290 513340 ~ 513737 (+)
AMCG00018049 NA coding downstream 71486 516536 ~ 520955 (+)
G114018 NA non-coding downstream 23738 468788 ~ 472124 (+)
G114056 NA non-coding downstream 108160 553210 ~ 553504 (+)
G114205 NA non-coding downstream 717842 1162892 ~ 1178095 (+)
G114237 NA non-coding downstream 821790 1266840 ~ 1268893 (+)
G114253 NA non-coding downstream 845505 1290555 ~ 1291851 (+)
G114053 snn,LOC107703342,LOC107564698 other downstream 130210 575260 ~ 579704 (+)
G114123 NA other downstream 332333 777383 ~ 794790 (+)
AMCG00018072 LOC107720077 other downstream 426271 871321 ~ 889033 (+)
G114219 NA other downstream 774729 1219779 ~ 1220216 (+)
G114320 adap1,LOC108228240,LOC107388258,LOC102218716 other downstream 1502791 1947841 ~ 1949593 (+)

Expression


Co-expression Network