AMCG00018052 (snn,LOC107703342,LOC107564698)


Basic Information

Item Value
gene id AMCG00018052
gene name snn,LOC107703342,LOC107564698
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 578048 ~ 578311 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018052
ATGTCCATCATGGACCACAGCCCCACCACAGGGGTGGTGACGGTCATCGTGATCCTCATCGCCATCGCCGCGCTGGGCGCCCTTATCCTCGGCTGCTGGTGCTACCTGCGTCTGCAGCGCATCGGCCAGTCCGAGGATGAGGAGAGCATCGTGGGGGAGGGCGAGACCAAGGAGCCCTTCCTGCTGGTGCAGTACTCGGCCAAGGGGCCACGTGTCGAGCGCAAGACCAAGCTGACGCCCAACGGCCCCGAGAGCCACAGTTAA

Function

symbol description
snn Predicted to be located in mitochondrial outer membrane. Predicted to be integral component of membrane. Orthologous to human SNN (stannin).

NR:

description
PREDICTED: stannin

GO:

id name namespace
GO:0016021 integral component of membrane cellular_component
GO:0005741 mitochondrial outer membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018052 True 264 mRNA 0.65 1 578048 578311

Neighbor

gene id symbol gene type direction distance location
AMCG00018057 NA coding upstream 2663 575104 ~ 575385 (+)
AMCG00018049 NA coding upstream 57093 516536 ~ 520955 (+)
AMCG00018053 NA coding upstream 64311 513340 ~ 513737 (+)
AMCG00018050 NA coding upstream 65027 501542 ~ 513021 (+)
AMCG00018051 eif3b,eif3ba coding upstream 78582 490119 ~ 499466 (+)
AMCG00018060 NA coding downstream 26019 604330 ~ 609917 (+)
AMCG00018061 LOC106607234 coding downstream 34178 612489 ~ 615795 (+)
AMCG00018062 NA coding downstream 44667 622978 ~ 637087 (+)
AMCG00018059 NA coding downstream 79371 657682 ~ 662116 (+)
AMCG00018058 NA coding downstream 89643 667954 ~ 671836 (+)
G114056 NA non-coding upstream 24544 553210 ~ 553504 (+)
G114018 NA non-coding upstream 105924 468788 ~ 472124 (+)
G114205 NA non-coding downstream 584581 1162892 ~ 1178095 (+)
G114237 NA non-coding downstream 688529 1266840 ~ 1268893 (+)
G114253 NA non-coding downstream 712244 1290555 ~ 1291851 (+)
G114274 NA non-coding downstream 955164 1533475 ~ 1534982 (+)
G114299 NA non-coding downstream 1286246 1864557 ~ 1865570 (+)
G114123 NA other downstream 199072 777383 ~ 794790 (+)
AMCG00018072 LOC107720077 other downstream 293010 871321 ~ 889033 (+)
G114219 NA other downstream 641468 1219779 ~ 1220216 (+)
G114320 adap1,LOC108228240,LOC107388258,LOC102218716 other downstream 1369530 1947841 ~ 1949593 (+)
AMCG00018105 NA other downstream 1394527 1972838 ~ 1973924 (+)

Expression


Co-expression Network