AMCG00018311 (gsg1l,LOC107738642,LOC107690243,LOC107685933,LOC103366699)


Basic Information

Item Value
gene id AMCG00018311
gene name gsg1l,LOC107738642,LOC107690243,LOC107685933,LOC103366699
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 7944117 ~ 7972869 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018311
ATGAAGACCACTCGGAAATGCCGAGCCCTGCTGTCCGTGGGTTTGAATCTGGTGGCCCTGTTCTTCTCCACGACCGCTTTCATCACGACTTACTGGTGCGAGGGGACGCAGAGGGTCCCCAAGCCCAACTGCAGCAAAGAGCGGCTGCACAACTGCATCAACTACGGGGTCAACGAGACGGACCAGAGCAAAGTCCACTACAGCTGGGAGACCGGGGACGACCGGTTCCTCTTCAGGCATTTCCACACCGGCATCTGGTACTCGTGTGAGGAGAACATCAACGGGGGAGGTGAGAAATGCAGAAGCTTTATTGATCTGGCCCCAGCATCGGAGAGGGGTGTCCTTTGGCTGTCAGTGGTGTCTGAAGTGCTATACATCATGCTTCTGGTCGTTGGCTTCAGTCTAATGTGCCTCGAACTCTTTCACTCAAGCAATGTGATAGATGGACTCAAGCTCAATGCCTTCGCCGCCGTTTTCACTGTTCTCTCAGGGCTCCTGGGAATGGTGGCTCACATGATGTACACACAAGTGTTCCAGGTGACTGTCAGCTTGGGGCCTGAGGACTGGAGACCACACACCTGGGACTATGGCTGGTCCTTCTGCCTGGCCTGGGGCTCATTTACCTGCTGCATGGCCGCCTCCGTCACCACTCTGAACTCCTACACAAAGACTGTCATCGAGTTCCGCCACAAGCGCAAGATGTTTGAGCAGGGTCTCCGCGAGGAGCAAACTTTTATTGACCAGGAGGCCCTCAACTATTTCCGGGACAGGTCCGTCCAGTCCATCTCGAGTTCGGTGGAGGTTTTCCCAGGGCCAGGGGGTAGTGGGGGCAAATCTCTGGGGCCTGCAGCCTCTGTAGACCTGGGGGAGATCCCCGAGTCACTGGGAGAAGAACAGTGCTGA

Function

symbol description
gsg1l Predicted to be located in membrane and synapse. Predicted to be integral component of membrane. Predicted to be active in plasma membrane. Is expressed in midbrain hindbrain boundary. Orthologous to human GSG1L (GSG1 like).

NR:

description
PREDICTED: germ cell-specific gene 1-like protein

GO:

id name namespace
GO:0045202 synapse cellular_component
GO:0005886 plasma membrane cellular_component
GO:0030054 cell junction cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018311 True 903 mRNA 0.56 5 7944117 7972869

Neighbor

gene id symbol gene type direction distance location
AMCG00018310 fbxl16,LOC107568165,LOC107685932,LOC107738613,LOC107568127,LOC107690242,LOC107733860 coding downstream 49548 7883207 ~ 7894569 (-)
AMCG00018306 NA coding downstream 180358 7745096 ~ 7763759 (-)
AMCG00018307 NA coding downstream 200439 7721264 ~ 7743678 (-)
AMCG00018303 rbfox1,LOC107568067 coding downstream 783483 7153091 ~ 7160634 (-)
AMCG00018302 LOC107568067,LOC107685930,LOC107733849 coding downstream 807270 7133898 ~ 7136847 (-)
AMCG00018314 NA coding upstream 67641 8040510 ~ 8045893 (-)
AMCG00018315 NA coding upstream 95332 8068201 ~ 8073947 (-)
AMCG00018316 NA coding upstream 106366 8079235 ~ 8081255 (-)
AMCG00018322 NA coding upstream 147119 8119988 ~ 8122196 (-)
AMCG00018323 NA coding upstream 150449 8123318 ~ 8140246 (-)
G115599 sept12,LOC107568113,LOC107690244,LOC107733855 non-coding downstream 75491 7860316 ~ 7868626 (-)
G115596 NA non-coding downstream 101409 7842337 ~ 7842708 (-)
G115580 NA non-coding downstream 201370 7742541 ~ 7742747 (-)
G115579 NA non-coding downstream 201907 7741974 ~ 7742210 (-)
G115577 NA non-coding downstream 209733 7734097 ~ 7734384 (-)
G115732 NA non-coding upstream 457257 8430126 ~ 8433570 (-)
G115807 NA non-coding upstream 544465 8517334 ~ 8519203 (-)
G115874 NA non-coding upstream 889004 8861873 ~ 8862377 (-)
G115949 NA non-coding upstream 1227931 9200800 ~ 9215817 (-)
G116058 NA non-coding upstream 1508041 9480910 ~ 9482152 (-)
G115581 NA other downstream 170225 7743218 ~ 7773892 (-)
AMCG00018291 NA other downstream 1291344 6610633 ~ 6652773 (-)
G115320 NA other downstream 1993062 5950421 ~ 5951055 (-)
AMCG00018251 natd1,LOC107745813 other downstream 2577363 5356846 ~ 5366754 (-)
G115183 NA other downstream 2639688 5300107 ~ 5304429 (-)
AMCG00018344 NA other upstream 669027 8641896 ~ 8648807 (-)
AMCG00018339 NA other upstream 693868 8666737 ~ 8676808 (-)
AMCG00018364 ubald1,LOC105031098,LOC105928896,LOC106589553,LOC103131586 other upstream 1266943 9239812 ~ 9258202 (-)
AMCG00018390 snu13,LOC101154660,LOC105910236 other upstream 1801437 9774306 ~ 9779545 (-)
G116165 NA other upstream 1946177 9919046 ~ 9924582 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000069_01571371_01593400 GSG1L coding CI01000069 null 1571371 ~ 1593400 (-)