AMCG00018354



Basic Information


Item Value
gene id AMCG00018354
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 9020003 ~ 9021898 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00018354
ATGCTTCCTGTCTTAGCACTCATGAAATATTCACCAGCTCTCCACAGCTGTCCCCCGGAGTGGAATTACCCACTTGGCTGTGGCACCCACCCTGCGGAGAAGGCCAACGATGACTTCTACACGAAGAGGCGGCACTTGGCTGAGTTGGCTGCCAAGGGTAGCCTGCCCCTGCACCCCATGCGTGTGGACCATGACCCTGGGGTGCCCTTCAGCCCCGAGATGGCCTGCAACAAGCAGAATGGCCACAAAACTAAAAGCAGCAAAGTGCACACAACACATCCCTTGGCCTACAGCTCCAACACCATCGCCAACCCCGGCGCCATGAAGGGCTGGAATGGCACGGAGACAATGGGCCGCAGGCAGACCTATGGGCCCAAGAAGCATTGCACGGTGGAGCAAGTCAATGAGCTCCACAGTGCCCGCAGCCACCACTACCTGCCCCCCCAACCCTACTTCGTGACCAACAGCAAGACAGAGGTGACTGTGTGA

Function


GO:

id name namespace
GO:0048172 regulation of short-term neuronal synaptic plasticity biological_process
GO:0032591 dendritic spine membrane cellular_component
GO:0045202 synapse cellular_component
GO:0008328 ionotropic glutamate receptor complex cellular_component
GO:0030054 cell junction cellular_component

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00018354 True 489 mRNA 0.58 3 9020003 9021898

Neighbor


gene id symbol gene type direction distance location
AMCG00018351 NA coding upstream 78367 8937615 ~ 8941636 (+)
AMCG00018350 NA coding upstream 82401 8932090 ~ 8937602 (+)
AMCG00018348 snx29,LOC107554039 coding upstream 172819 8813019 ~ 8847184 (+)
AMCG00018349 NA coding upstream 209529 8783629 ~ 8810474 (+)
AMCG00018345 snx29,LOC107554010 coding upstream 288075 8718740 ~ 8731928 (+)
AMCG00018356 NA coding downstream 102415 9124313 ~ 9130120 (+)
AMCG00018357 NA coding downstream 134283 9156181 ~ 9156453 (+)
AMCG00018355 NA coding downstream 140588 9162486 ~ 9187759 (+)
AMCG00018359 mgrn1 coding downstream 237556 9259454 ~ 9285418 (+)
AMCG00018366 NA coding downstream 269434 9291332 ~ 9295905 (+)
G115875 NA non-coding upstream 149661 8868542 ~ 8870342 (+)
G115873 NA non-coding upstream 157492 8862081 ~ 8862511 (+)
G115796 NA non-coding upstream 315100 8703157 ~ 8704903 (+)
G115678 NA non-coding upstream 647176 8352077 ~ 8372827 (+)
G115679 NA non-coding upstream 672167 8294416 ~ 8347836 (+)
G115896 NA non-coding downstream 14432 9036330 ~ 9036583 (+)
G115931 NA non-coding downstream 176979 9198877 ~ 9199440 (+)
G115939 NA non-coding downstream 206112 9228010 ~ 9230141 (+)
G115990 NA non-coding downstream 415134 9437032 ~ 9437303 (+)
G116002 NA non-coding downstream 450599 9472497 ~ 9477108 (+)
G115789 NA other upstream 325284 8693364 ~ 8694719 (+)
G115648 NA other upstream 897832 8119778 ~ 8122171 (+)
G115590 fbxl16,LOC107685932,LOC107568165,LOC107738613,LOC107568127,LOC107690242 other upstream 1125554 7893627 ~ 7894449 (+)
AMCG00018280 NA other upstream 2272565 6710482 ~ 6747438 (+)
AMCG00018272 NA other upstream 2859387 6155488 ~ 6160616 (+)
AMCG00018358 polr3k,rpc11 other downstream 177759 9199657 ~ 9206776 (+)
AMCG00018360 f100a other downstream 217913 9239811 ~ 9245234 (+)
AMCG00018368 NA other downstream 417759 9439657 ~ 9447144 (+)
AMCG00018369 NA other downstream 459054 9480952 ~ 9486146 (+)
AMCG00018374 NA other downstream 490416 9512314 ~ 9513236 (+)

Expression



Co-expression Network