AMCG00018511


Basic Information

Item Value
gene id AMCG00018511
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 13087461 ~ 13088726 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018511
CTATGGTTCCCCAGGTGTTGAATTCACAGGTCTACACAAGGACATGGCCACTGTGACTCAGATGCACTTTCTGCCTGGACAGGGGCGGCTGCTGTCCTTGCTGGATGACAATACCCTACACCTGTGGGAGATCAGTCTGCGGGAGGGGGCTACACAGCTGGAGGAGATCCGCAGCTTCACCCTGCCGGGACGGCCTGGCATCGAGAGCACA

Function

GO:

id name namespace
GO:0003407 neural retina development biological_process
GO:0008593 regulation of Notch signaling pathway biological_process
GO:0048919 posterior lateral line neuromast development biological_process
GO:0016323 basolateral plasma membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018511 True 211 mRNA 0.59 2 13087461 13088726

Neighbor

gene id symbol gene type direction distance location
AMCG00018506 NA coding upstream 43775 13033006 ~ 13043686 (+)
AMCG00018508 NA coding upstream 55673 12958712 ~ 13031788 (+)
AMCG00018507 drg2 coding upstream 144166 12934596 ~ 12943295 (+)
AMCG00018503 znf598 coding upstream 182960 12885187 ~ 12904501 (+)
AMCG00018502 cacna1h,LOC108430011 coding upstream 208580 12836224 ~ 12878881 (+)
AMCG00018510 llgl1,LOC107674688,LOC107592402 coding downstream 11877 13100603 ~ 13123386 (+)
AMCG00018509 NA coding downstream 73931 13162657 ~ 13166145 (+)
AMCG00018514 NA coding downstream 99197 13187923 ~ 13196197 (+)
AMCG00018516 bud31,LOC106595689 coding downstream 146475 13235201 ~ 13237686 (+)
AMCG00018515 cpsf4,LOC107578701,LOC107720053 coding downstream 157808 13246534 ~ 13252245 (+)
G116775 NA non-coding upstream 39367 13047117 ~ 13048094 (+)
G116765 NA non-coding upstream 128909 12905100 ~ 12958552 (+)
G116769 NA non-coding upstream 152897 12932940 ~ 12934564 (+)
G116728 NA non-coding upstream 203547 12879586 ~ 12883914 (+)
G116725 NA non-coding upstream 386696 12700501 ~ 12700765 (+)
G116790 NA non-coding downstream 41012 13129738 ~ 13215352 (+)
G116882 NA non-coding downstream 277914 13366640 ~ 13367028 (+)
G116941 NA non-coding downstream 577297 13666023 ~ 13691367 (+)
G116975 NA non-coding downstream 750990 13839716 ~ 13839971 (+)
G116976 NA non-coding downstream 758164 13846890 ~ 13847092 (+)
AMCG00018498 NA other upstream 475582 12543545 ~ 12611879 (+)
AMCG00018491 slc5a10 other upstream 567130 12503023 ~ 12520331 (+)
AMCG00018493 prpsap2,LOC107737786,LOC107581734,LOC107720040,LOC107654541 other upstream 587407 12489467 ~ 12500054 (+)
G116585 rbbp6,LOC107689611 other upstream 1116683 11966247 ~ 11970778 (+)
AMCG00018449 msrb1,LOC107376545,LOC105933050 other upstream 1831296 11252359 ~ 11256165 (+)
G116832 NA other downstream 164617 13253343 ~ 13255794 (+)
AMCG00018520 slc29a4,LOC107703421,LOC107737679,LOC107581724 other downstream 219172 13307898 ~ 13346877 (+)
AMCG00018537 radil,LOC107725399,LOC107722964,LOC107590699,LOC107564693 other downstream 909183 13997909 ~ 14022806 (+)
G117033 NA other downstream 957533 14046259 ~ 14049153 (+)
AMCG00018538 LOC103397138,LOC107554284,LOC100698873 other downstream 1052651 14141377 ~ 14145995 (+)

Expression


Co-expression Network