AMCG00018633 (arvcf)


Basic Information

Item Value
gene id AMCG00018633
gene name arvcf
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 16089985 ~ 16096022 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018633
TTCGAGCTCCTGTACCAGCCTGAAGTGGTGAGGCTGTACCTGTCCCTCCTCACCGAGAGCCAGAACTACAACACGCTGGAGGCCGCAGCCGGGGCTCTGCAGAACCTCAGCGCGGGACAGTGGACGTGGTCCACGTACATCAGAGCCACAGTGCGGAAGGAGAAGGGGCTGCCCATCCTGGTGGAGCTGCTGCGGTCCGACTCCGACAAGGTGGTGCGTGCCGTGGCCATCGCCCTCCGAAACCTGTCCATCGACCGGCGCAACAAGGACCTCATAGGGAGCTACGCCATGCGGGACCTGGTCAGTAACTTGCCCAGCGGCCAGCAGAGACCCGCCAAGAACCTGGAGGAGGATACCGTGGTGGCCATACTCAACACCATCCACGAGATCGTGACGGACAGCTCGGAGAACGCCCGCTCCCTCATCCAAGCCCAGGCCATTGAGAAGCTGGTGGCCATCAACAGGACAAGCCAATCTCCACGAGAGACTAAAGCCGCATCTCACGTTCTTCAGACTGTGTGGAGCTACAAAGAGCTGAGAAACACACTCAACAAGGATGGCTGGAACAAGACACACTTCCAGCCGACCACGGCTGCTCTCCCCAAAGGATCCAAGAGCAACAAGAAATCTGGCAGTGGGGATGTGATTCCAATGGATGAGCTCGGGCCAGATGGCTACTCCACTATTGATCAGAGGGACAAGGAGAGCAAATACAAGACTGGCGATGGCTCGGGAGATGTGACGGAGCGAGAACCTTTA

Function

symbol description
arvcf Predicted to enable cadherin binding activity. Predicted to be involved in cell-cell adhesion and cell-cell junction assembly. Predicted to be located in cell junction. Predicted to be active in several cellular components, including adherens junction; nucleus; and plasma membrane. Implicated in DiGeorge syndrome.

NR:

description
PREDICTED: armadillo repeat protein deleted in velo-cardio-facial syndrome isoform X2

GO:

id name namespace
GO:0007275 multicellular organism development biological_process
GO:0016339 calcium-dependent cell-cell adhesion via plasma membrane cell adhesion molecules biological_process
GO:0005886 plasma membrane cellular_component
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018633 True 759 mRNA 0.58 7 16089985 16096022

Neighbor

gene id symbol gene type direction distance location
AMCG00018634 NA coding downstream 8659 16060706 ~ 16081326 (-)
AMCG00018631 NA coding downstream 39096 16032700 ~ 16050889 (-)
AMCG00018628 cltcl1,LOC106585059 coding downstream 195161 15863081 ~ 15894824 (-)
AMCG00018629 slc25a1b,LOC107665756,LOC107751928,LOC108247150,LOC107704153,LOC107706761 coding downstream 241034 15831182 ~ 15848951 (-)
AMCG00018627 NA coding downstream 264538 15795181 ~ 15825447 (-)
AMCG00018632 arvcf,LOC102781924 coding upstream 19943 16115965 ~ 16143336 (-)
AMCG00018640 trmt2a,LOC107687689,LOC106580466,LOC107672731 coding upstream 193812 16289834 ~ 16293685 (-)
AMCG00018639 zdhhc8,LOC107707819 coding upstream 205892 16301914 ~ 16325216 (-)
AMCG00018642 LOC102797792,LOC102795364 coding upstream 282681 16378703 ~ 16391388 (-)
AMCG00018643 NA coding upstream 298934 16394956 ~ 16409595 (-)
G117646 tbx1 non-coding downstream 64912 16022598 ~ 16025073 (-)
G117501 NA non-coding downstream 875554 15214168 ~ 15214431 (-)
G117472 NA non-coding downstream 1109601 14979041 ~ 14980384 (-)
G117441 NA non-coding downstream 1232390 14856420 ~ 14857595 (-)
G117438 NA non-coding downstream 1254260 14833856 ~ 14835725 (-)
G117710 NA non-coding upstream 198808 16294830 ~ 16296445 (-)
G117809 NA non-coding upstream 1057980 17154002 ~ 17155261 (-)
G117853 NA non-coding upstream 1370112 17466134 ~ 17466434 (-)
G117856 NA non-coding upstream 1418835 17514857 ~ 17515120 (-)
G117888 NA non-coding upstream 1488729 17584751 ~ 17585098 (-)
AMCG00018617 ypel1,YPEL1,ypelc,ypel2b,LOC106931471,LOC103374080,LOC108277989,LOC106586007,LOC106940241 other downstream 571670 15498662 ~ 15518315 (-)
G117377 NA other downstream 1351673 14736138 ~ 14738312 (-)
G117267 ywhag,143g1,ywhag1,LOC106603950,LOC108233911,LOC107387033 other downstream 1569110 14503403 ~ 14520875 (-)
AMCG00018555 LOC107689851 other downstream 1826831 14242545 ~ 14263154 (-)
AMCG00018528 LOC104956910,LOC107742399,LOC107591749,LOC106595856 other downstream 2362115 13645368 ~ 13727870 (-)
G117784 NA other upstream 912876 17008898 ~ 17009301 (-)
G117823 NA other upstream 1130068 17226090 ~ 17256271 (-)
G117899 NA other upstream 1507334 17603356 ~ 17603848 (-)
G118075 NA other upstream 2370346 18466368 ~ 18474245 (-)
AMCG00018687 NA other upstream 2442396 18538418 ~ 18547368 (-)

Expression


Co-expression Network