AMCG00018649 (galnt9,LOC103141400,LOC106920899,LOC106962167)


Basic Information

Item Value
gene id AMCG00018649
gene name galnt9,LOC103141400,LOC106920899,LOC106962167
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 16963043 ~ 16977083 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018649
ATGGGCCTAGTGGAGGGACCAGGGGGACTCGGGCAAGGAGGTGCCGCTGCTACCCTAAGGGACGATAGCCATGAATCTGAGAGCAAGTATGAAGAATACGGCTACAACGCCCAGCTCAGCGATAGGATATCACTGGATAGGGCCATTCCAGACTACAGACCAAAAAAGTGCAAGCAAATGACCTATCCAGATGACCTCCCTCAGATCTCAGTGGTCTTTATCTTTGTGAACGAAGCCCTCTCAGTGATCTTGCGGTCTGTGCACAGCGTGGTCAATCACACGCCTGCTCACCTGCTCAAGGAGATCATCCTCGTGGATGATAACAGCGATAGCGTGGAGCTGAAGTTCAATCTTGACCAATATGTCAACAAGAGGTACCCAGGTTTGGTGAAGATTGTGCGCAACAACAAGCGAGAAGGTCTGATCCGAGCCAGGATTCATGGATGGAAAGCAGCTACGGCTCCTATCGTGGGTTTCTTTGATGCCCATGTGGAGTTTAACACCGCCTGGTAA

Function

symbol description
galnt9 Predicted to enable carbohydrate binding activity and hexosyltransferase activity. Predicted to be involved in protein glycosylation. Predicted to be located in Golgi membrane. Predicted to be integral component of membrane. Predicted to be active in Golgi apparatus. Is expressed in hindbrain; midbrain; and telencephalon. Orthologous to human GALNT9 (polypeptide N-acetylgalactosaminyltransferase 9).

NR:

description
PREDICTED: polypeptide N-acetylgalactosaminyltransferase 9

GO:

id name namespace
GO:0006486 protein glycosylation biological_process
GO:0005794 Golgi apparatus cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0016757 transferase activity, transferring glycosyl groups molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018649 True 513 mRNA 0.51 3 16963043 16977083

Neighbor

gene id symbol gene type direction distance location
AMCG00018651 LOC106920899,LOC106940379,LOC107600134 coding downstream 39449 16912767 ~ 16923594 (-)
AMCG00018646 LOC106580457 coding downstream 215082 16747653 ~ 16747961 (-)
AMCG00018645 NA coding downstream 477455 16464741 ~ 16485588 (-)
AMCG00018644 chfr,LOC100195666,LOC106580459,LOC102788874 coding downstream 500680 16438631 ~ 16462363 (-)
AMCG00018643 NA coding downstream 553448 16394956 ~ 16409595 (-)
AMCG00018650 NA coding upstream 91129 17068212 ~ 17070690 (-)
AMCG00018652 znrf3 coding upstream 179137 17156220 ~ 17168116 (-)
AMCG00018653 znrf3,LOC106584905 coding upstream 202006 17179089 ~ 17224239 (-)
AMCG00018656 NA coding upstream 290506 17267589 ~ 17290539 (-)
AMCG00018658 NA coding upstream 321181 17298264 ~ 17304621 (-)
G117710 NA non-coding downstream 666598 16294830 ~ 16296445 (-)
G117646 tbx1 non-coding downstream 937970 16022598 ~ 16025073 (-)
G117501 NA non-coding downstream 1748612 15214168 ~ 15214431 (-)
G117472 NA non-coding downstream 1982659 14979041 ~ 14980384 (-)
G117441 NA non-coding downstream 2105448 14856420 ~ 14857595 (-)
G117809 NA non-coding upstream 176919 17154002 ~ 17155261 (-)
G117853 NA non-coding upstream 489051 17466134 ~ 17466434 (-)
G117856 NA non-coding upstream 537774 17514857 ~ 17515120 (-)
G117888 NA non-coding upstream 607668 17584751 ~ 17585098 (-)
G117916 NA non-coding upstream 757593 17734676 ~ 17736324 (-)
AMCG00018617 ypel1,YPEL1,ypelc,ypel2b,LOC106931471,LOC103374080,LOC108277989,LOC106586007,LOC106940241 other downstream 1444728 15498662 ~ 15518315 (-)
G117377 NA other downstream 2224731 14736138 ~ 14738312 (-)
G117267 ywhag,143g1,ywhag1,LOC106603950,LOC108233911,LOC107387033 other downstream 2442168 14503403 ~ 14520875 (-)
AMCG00018555 LOC107689851 other downstream 2699889 14242545 ~ 14263154 (-)
AMCG00018528 LOC104956910,LOC107742399,LOC107591749,LOC106595856 other downstream 3235173 13645368 ~ 13727870 (-)
G117784 NA other upstream 31815 17008898 ~ 17009301 (-)
G117823 NA other upstream 249007 17226090 ~ 17256271 (-)
G117899 NA other upstream 626273 17603356 ~ 17603848 (-)
G118075 NA other upstream 1489285 18466368 ~ 18474245 (-)
AMCG00018687 NA other upstream 1561335 18538418 ~ 18547368 (-)

Expression


Co-expression Network