AMCG00018908


Basic Information

Item Value
gene id AMCG00018908
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 25136587 ~ 25144798 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018908
AAAGTCTCTCTGGGAACTCGTTGTAGAGCAGTTCGAAGATTTATTAGTACGAATTCTTCTTCTGGCAGCTTGTATATCTTTTGTACTGGCCTGGTTCGAGGAGGGAGAGGAAACGATTACAGCTTTTGTGGAACCTTTTGTAATCTTACTTATTCTAATAGCCAATGCCATTGTGGGTGTGTG

Function

GO:

id name namespace
GO:0070588 calcium ion transmembrane transport biological_process
GO:0006200 obsolete ATP catabolic process biological_process
GO:0031448 positive regulation of fast-twitch skeletal muscle fiber contraction biological_process
GO:0045988 negative regulation of striated muscle contraction biological_process
GO:0048471 perinuclear region of cytoplasm cellular_component
GO:0005793 endoplasmic reticulum-Golgi intermediate compartment cellular_component
GO:0033017 sarcoplasmic reticulum membrane cellular_component
GO:0031673 H zone cellular_component
GO:0031674 I band cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005388 calcium transmembrane transporter activity, phosphorylative mechanism molecular_function
GO:0005509 calcium ion binding molecular_function
GO:0005524 ATP binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018908 True 183 mRNA 0.42 2 25136587 25144798

Neighbor

gene id symbol gene type direction distance location
AMCG00018897 LOC106585468,LOC104958862 coding upstream 19168 25091131 ~ 25117419 (+)
AMCG00018899 NA coding upstream 46302 25084176 ~ 25090285 (+)
AMCG00018886 selenom,selm,LOC103043669 coding upstream 423059 24709674 ~ 24713528 (+)
AMCG00018876 NA coding upstream 758659 24372640 ~ 24377928 (+)
AMCG00018850 gucd1,LOC106585462 coding upstream 2265814 22862980 ~ 22870773 (+)
AMCG00018902 LOC103365013,LOC102776280 coding downstream 26687 25171485 ~ 25188842 (+)
AMCG00018901 LOC103152401,LOC106931442,LOC103469522,LOC102221826,LOC101074150,LOC101161315,LOC105014186,LOC106579958,LOC103397036 coding downstream 58874 25203672 ~ 25213155 (+)
AMCG00018900 NA coding downstream 100847 25245645 ~ 25261282 (+)
AMCG00018909 NA coding downstream 142610 25287408 ~ 25294157 (+)
AMCG00018915 NA coding downstream 389305 25534103 ~ 25544880 (+)
G119429 NA non-coding upstream 285537 24850836 ~ 24851050 (+)
G119416 NA non-coding upstream 300878 24799950 ~ 24835709 (+)
G119419 NA non-coding upstream 326768 24807747 ~ 24809819 (+)
G119354 NA non-coding upstream 537573 24537666 ~ 24599014 (+)
G119523 NA non-coding downstream 158388 25303186 ~ 25313495 (+)
G119529 LOC108239856,LOC103139559,LOC107385499,LOC103366907 non-coding downstream 186592 25331390 ~ 25338189 (+)
G119574 NA non-coding downstream 341047 25485845 ~ 25488149 (+)
G119669 NA non-coding downstream 894481 26039279 ~ 26078413 (+)
G119682 NA non-coding downstream 962671 26107469 ~ 26107849 (+)
AMCG00018820 NA other upstream 3238887 21848370 ~ 21897700 (+)
G118815 NA other upstream 3947341 21187956 ~ 21189246 (+)
AMCG00018802 dnah10,LOC102798403,LOC105907537,LOC105907538 other upstream 4364001 20723610 ~ 20772586 (+)
AMCG00018800 ddx55,gtf2h3,eif2b1 other upstream 4441393 20679280 ~ 20695194 (+)
AMCG00018792 LOC106928543 other upstream 4533272 20601956 ~ 20603315 (+)
G119507 NA other downstream 89284 25234082 ~ 25267781 (+)
AMCG00018913 NA other downstream 321293 25466091 ~ 25485446 (+)
AMCG00018922 med13l other downstream 533879 25678677 ~ 25718426 (+)
G119762 NA other downstream 1315822 26460620 ~ 26461227 (+)

Expression


Co-expression Network