AMCG00018928 (rasl10a,LOC106584972)


Basic Information

Item Value
gene id AMCG00018928
gene name rasl10a,LOC106584972
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 26623824 ~ 26625548 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018928
GAGTGGGTGGATCTACGATGCCGGGGAGTGCGGAACGCCAGTGCATACATCCTGGTCTACAATATTTGCTGTGTAGGGAGCTTTGAATATGTGAAAATGATCCGGCAACAGATTGTGGAGCACAGAGTGGGCAACAGCAGTGAGATTCCTATCTTGGTGGTGGGGAGCAAAAGGGACCTCCAACGGCAGCGCTTCACCCCCCGCAGGGCCGTGTCGGTGCTAGTGAAGAAGACCTGGAAGTGCGGCTATGTGGAGTGCTCGGCCAAGTACAACTGGCACATCACCCTGCTGTTCAAAGAGCTCCTGTGCAGCACAGTGGCCCATGGCCTCAAACACAATTACAGCTCCATCCGCCTGCAGGGGGCACTGCACCGCAACCGCTGCAACATCATGTGA

Function

symbol description
rasl10a Predicted to enable GTP binding activity and GTPase activity. Predicted to act upstream of or within signal transduction. Predicted to be located in membrane. Orthologous to several human genes including RASL10B (RAS like family 10 member B).

NR:

description
PREDICTED: ras-like protein family member 10A

GO:

id name namespace
GO:0007264 small GTPase mediated signal transduction biological_process
GO:0006184 obsolete GTP catabolic process biological_process
GO:0016020 membrane cellular_component
GO:0003924 GTPase activity molecular_function
GO:0005525 GTP binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018928 True 396 mRNA 0.56 2 26623824 26625548

Neighbor

gene id symbol gene type direction distance location
AMCG00018926 NA coding downstream 213039 26367350 ~ 26410785 (-)
AMCG00018925 slc35e4 coding downstream 267216 26344630 ~ 26356608 (-)
AMCG00018920 NA coding downstream 1023161 25596536 ~ 25600663 (-)
AMCG00018917 NA coding downstream 1070732 25547542 ~ 25553092 (-)
AMCG00018916 NA coding downstream 1090468 25489444 ~ 25533356 (-)
AMCG00018931 ap1b1 coding upstream 107719 26733267 ~ 26771289 (-)
AMCG00018933 gas2l1,LOC106580329 coding upstream 199714 26825262 ~ 26825957 (-)
AMCG00018932 NA coding upstream 219222 26844770 ~ 26869193 (-)
AMCG00018938 LOC107673410,LOC107730716,LOC107592308 coding upstream 247346 26872894 ~ 26943014 (-)
AMCG00018937 NA coding upstream 317516 26943064 ~ 27063981 (-)
G119774 NA non-coding downstream 121904 26501001 ~ 26501920 (-)
G119770 NA non-coding downstream 162664 26460618 ~ 26461160 (-)
G119713 NA non-coding downstream 280746 26319977 ~ 26343078 (-)
G119691 NA non-coding downstream 472753 26119422 ~ 26151071 (-)
G119685 NA non-coding downstream 510671 26112864 ~ 26113153 (-)
G119825 NA non-coding upstream 185336 26810884 ~ 26812556 (-)
G119826 NA non-coding upstream 187566 26813114 ~ 26813426 (-)
G119891 NA non-coding upstream 596958 27222506 ~ 27278009 (-)
G119912 NA non-coding upstream 730277 27355825 ~ 27356032 (-)
G119929 NA non-coding upstream 839839 27465387 ~ 27468649 (-)
AMCG00018929 NA other downstream 138509 26451724 ~ 26485315 (-)
G119545 NA other downstream 1436416 25186207 ~ 25187408 (-)
G119538 LOC108444117,LOC105014832,LOC106563153 other downstream 1452180 25134771 ~ 25171644 (-)
AMCG00018898 NA other downstream 1539238 25075398 ~ 25084586 (-)
G119144 NA other downstream 3817486 22804345 ~ 22806338 (-)
AMCG00018930 NA other upstream 152087 26777635 ~ 26797720 (-)
G119827 NA other upstream 187932 26813480 ~ 26814073 (-)
G119893 LOC101154678 other upstream 605325 27230873 ~ 27242574 (-)

Expression


Co-expression Network