AMCG00018939 (dtx1)


Basic Information

Item Value
gene id AMCG00018939
gene name dtx1
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 27073796 ~ 27075433 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018939
ATGGCGCGACCCGGCTCCACAGTGATGATCCCTATAAATGGGCTGGGGTATCCCCCCCAGAACCTGGCACGGGTGGTGGTGTGGGAGTGGCTGAATGAGCATGGGCGTTGGAGGCCCTACAGTGCAGCCGTGTGCCACCACATCGAGAACGTGCTGAAGACCGACTCCCGGGGGACTGTGGTGCTTGGGCAAGTTGACCCCCAGCTGGCTCCCTATATCATAGACCTACAGTCCATGCATCAGTTTCGACAAGATACTGGGTTGTAA

Function

symbol description
dtx1 Predicted to enable transferase activity and zinc ion binding activity. Acts upstream of with a negative effect on Notch signaling pathway. Acts upstream of or within glial cell differentiation and neuron differentiation. Predicted to be located in cytoplasm. Is expressed in nervous system and spinal cord neural tube. Orthologous to human DTX1 (deltex E3 ubiquitin ligase 1).

NR:

description
PREDICTED: E3 ubiquitin-protein ligase DTX1 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018939 True 267 mRNA 0.58 2 27073796 27075433

Neighbor

gene id symbol gene type direction distance location
AMCG00018935 NA coding upstream 24594 27048846 ~ 27049202 (+)
AMCG00018936 NA coding upstream 25089 27047766 ~ 27048707 (+)
AMCG00018934 NA coding upstream 197959 26872850 ~ 26875837 (+)
AMCG00018927 NA coding upstream 635483 26431716 ~ 26438313 (+)
AMCG00018924 tbx5,tbx5a,LOC107670381,LOC101474152 coding upstream 880312 26153655 ~ 26193484 (+)
AMCG00018942 NA coding downstream 126519 27201952 ~ 27202650 (+)
AMCG00018941 dtx1 coding downstream 184497 27259930 ~ 27273263 (+)
AMCG00018943 dgcr6,LOC101064501,LOC108430318 coding downstream 400068 27475501 ~ 27482021 (+)
AMCG00018944 slc7a4 coding downstream 424927 27500360 ~ 27513931 (+)
AMCG00018945 sf3a1 coding downstream 493007 27568440 ~ 27580251 (+)
G119836 NA non-coding upstream 218354 26849626 ~ 26855442 (+)
G119834 NA non-coding upstream 224298 26844689 ~ 26849498 (+)
G119820 gas2l1,LOC106580329 non-coding upstream 247204 26825215 ~ 26826592 (+)
G119817 NA non-coding upstream 295136 26777653 ~ 26778660 (+)
G119816 NA non-coding upstream 297597 26775743 ~ 26776199 (+)
G119897 NA non-coding downstream 205573 27281006 ~ 27281572 (+)
G119941 NA non-coding downstream 438886 27514319 ~ 27515546 (+)
G119940 NA non-coding downstream 442831 27518264 ~ 27519750 (+)
G119963 NA non-coding downstream 595200 27670633 ~ 27670834 (+)
G120029 NA non-coding downstream 839409 27914842 ~ 27915123 (+)
G119762 NA other upstream 612569 26460620 ~ 26461227 (+)
AMCG00018922 med13l other upstream 1355370 25678677 ~ 25718426 (+)
AMCG00018913 NA other upstream 1588350 25466091 ~ 25485446 (+)
G119507 NA other upstream 1806015 25234082 ~ 25267781 (+)
AMCG00018820 NA other upstream 5176096 21848370 ~ 21897700 (+)

Expression


Co-expression Network