AMCG00018941 (dtx1)


Basic Information

Item Value
gene id AMCG00018941
gene name dtx1
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 27259930 ~ 27273263 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018941
ATGTCCTTACTAGCCCTTCTTCTTTTCCAGGACTGCACCATCTGCATGGAGAGACTGGTCACCTCTTCTGGCTATGAGGGCGTTCTGAGCCACAGGGGGATCAAACCAGAGCTTGTGGGCAAGCTGGGCAAGTGTGGTCACATGTACCACCTCCTATGCCTGGTGGCTATGTACAACAATGGTAACAAGGACGGCAGCCTGCAGTGCCCTACATGCAAAGCCATCTATGGGGAGAAGACTGGCACACAGCCCCCTGGGAAGATGGAGTACCATGTGATACCCCACTGCCTGCCAGGATACCCAGAATCCAAGACCATCCGCATCGTCTATGATATCCCTGCTGGTATCCAGACCAATGAGCACCCAAACCCTGGGAAGAAGTTCAGTGCCAGGGGCTTCCCTCGGCACTGCTACCTGCCAGACAATGAGAAAGGCCAAAAGGTCTTGAAGCTCCTGATCATTGCATGGGACCGCCGGCTGATCTTCACTATCGGGACTTCCAACACCACGGGGGAGTCGGACACAGTGGTCTGGAACGAAATCCACCACAAGACCGAGTTCGGATCCAACCTGACAGGACATGGCTACCCTGACCCCAACTACCTAGACAATGTCTTGACAGAGCTTTCCACTCAAGGGGTGGGTGAGGAGGCCCTGAAGGACTGA

Function

symbol description
dtx1 Predicted to enable transferase activity and zinc ion binding activity. Acts upstream of with a negative effect on Notch signaling pathway. Acts upstream of or within glial cell differentiation and neuron differentiation. Predicted to be located in cytoplasm. Is expressed in nervous system and spinal cord neural tube. Orthologous to human DTX1 (deltex E3 ubiquitin ligase 1).

NR:

description
PREDICTED: E3 ubiquitin-protein ligase DTX1 isoform X2

GO: NA

KEGG:

id description
K06058 DTX; deltex

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018941 True 666 mRNA 0.55 4 27259930 27273263

Neighbor

gene id symbol gene type direction distance location
AMCG00018942 NA coding upstream 57280 27201952 ~ 27202650 (+)
AMCG00018939 dtx1 coding upstream 184497 27073796 ~ 27075433 (+)
AMCG00018935 NA coding upstream 210728 27048846 ~ 27049202 (+)
AMCG00018936 NA coding upstream 211223 27047766 ~ 27048707 (+)
AMCG00018934 NA coding upstream 384093 26872850 ~ 26875837 (+)
AMCG00018943 dgcr6,LOC101064501,LOC108430318 coding downstream 202238 27475501 ~ 27482021 (+)
AMCG00018944 slc7a4 coding downstream 227097 27500360 ~ 27513931 (+)
AMCG00018945 sf3a1 coding downstream 295177 27568440 ~ 27580251 (+)
AMCG00018949 NA coding downstream 352574 27625837 ~ 27662982 (+)
AMCG00018950 LOC107092734,LOC103375490,LOC103470605,LOC106921081 coding downstream 467764 27741027 ~ 27742100 (+)
G119836 NA non-coding upstream 404488 26849626 ~ 26855442 (+)
G119834 NA non-coding upstream 410432 26844689 ~ 26849498 (+)
G119820 gas2l1,LOC106580329 non-coding upstream 433338 26825215 ~ 26826592 (+)
G119817 NA non-coding upstream 481270 26777653 ~ 26778660 (+)
G119816 NA non-coding upstream 483731 26775743 ~ 26776199 (+)
G119897 NA non-coding downstream 7743 27281006 ~ 27281572 (+)
G119941 NA non-coding downstream 241056 27514319 ~ 27515546 (+)
G119940 NA non-coding downstream 245001 27518264 ~ 27519750 (+)
G119963 NA non-coding downstream 397370 27670633 ~ 27670834 (+)
G120029 NA non-coding downstream 641579 27914842 ~ 27915123 (+)
G119762 NA other upstream 798703 26460620 ~ 26461227 (+)
AMCG00018922 med13l other upstream 1541504 25678677 ~ 25718426 (+)
AMCG00018913 NA other upstream 1774484 25466091 ~ 25485446 (+)
G119507 NA other upstream 1992149 25234082 ~ 25267781 (+)
AMCG00018820 NA other upstream 5362230 21848370 ~ 21897700 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_038648 DTX1 coding NW_003336492.1 KN150578.1 14229 ~ 42858 (+)
grasscarp (Ctenopharyngodon idella) CI01000157_00500165_00508817 DTX1 coding CI01000157 null 499145 ~ 508817 (-)