G115577


Basic Information

Item Value
gene id G115577
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 7734097 ~ 7734384 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU144760
CTGTAATGGTGGTAAAATGTGAAGGCGATGTCATTGTTATCATCGGGGGAGTGATGTACTTTGCCTTCACCCCCTCTTGCACTAGGTAGTCCAGGTTTGGTGTTTCAACGTCCTGGTCATAGTTCCACCTAAAGCCATCAAAGGAAACCACCAACAACTTGTTGAAAGTCTTTCTCTTGGCCTGCAACGGTCTGCCTTCACCCTCGTGTATTAGAAGAACTGCAAGCAGGAAGAACCACCTTGCAGTCATTGTTTTAGATTATCTGATTGCTCGCGTGTGGTTCCAGA

Function

GO: NA

KEGG:

id description
ko04614 Renin-angiotensin system
ko04976 Bile secretion
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU144760 True 288 lncRNA 0.47 1 7734097 7734384

Neighbor

gene id symbol gene type direction distance location
AMCG00018303 rbfox1,LOC107568067 coding downstream 573463 7153091 ~ 7160634 (-)
AMCG00018302 LOC107568067,LOC107685930,LOC107733849 coding downstream 597250 7133898 ~ 7136847 (-)
AMCG00018304 NA coding downstream 857919 6866912 ~ 6876178 (-)
AMCG00018301 NA coding downstream 883303 6827619 ~ 6850794 (-)
AMCG00018299 NA coding downstream 907874 6821595 ~ 6826223 (-)
AMCG00018306 NA coding upstream 10712 7745096 ~ 7763759 (-)
AMCG00018310 fbxl16,LOC107568165,LOC107685932,LOC107738613,LOC107568127,LOC107690242,LOC107733860 coding upstream 148823 7883207 ~ 7894569 (-)
AMCG00018311 gsg1l,LOC107738642,LOC107690243,LOC107685933,LOC103366699 coding upstream 209733 7944117 ~ 7972869 (-)
AMCG00018314 NA coding upstream 306126 8040510 ~ 8045893 (-)
AMCG00018315 NA coding upstream 333817 8068201 ~ 8073947 (-)
G115534 NA non-coding downstream 732092 7001802 ~ 7002005 (-)
G115395 NA non-coding downstream 1514881 6217528 ~ 6219216 (-)
G115332 LOC100136012 non-coding downstream 1687479 6046030 ~ 6046618 (-)
G115279 NA non-coding downstream 1980075 5750092 ~ 5754022 (-)
G115278 NA non-coding downstream 1984054 5749783 ~ 5750043 (-)
G115579 NA non-coding upstream 7590 7741974 ~ 7742210 (-)
G115580 NA non-coding upstream 8157 7742541 ~ 7742747 (-)
G115596 NA non-coding upstream 107953 7842337 ~ 7842708 (-)
G115599 sept12,LOC107568113,LOC107690244,LOC107733855 non-coding upstream 125932 7860316 ~ 7868626 (-)
G115732 NA non-coding upstream 695742 8430126 ~ 8433570 (-)
AMCG00018291 NA other downstream 1081324 6610633 ~ 6652773 (-)
G115320 NA other downstream 1783042 5950421 ~ 5951055 (-)
AMCG00018251 natd1,LOC107745813 other downstream 2367343 5356846 ~ 5366754 (-)
G115183 NA other downstream 2429668 5300107 ~ 5304429 (-)
G115174 NA other downstream 2446224 5286386 ~ 5287873 (-)
G115581 NA other upstream 8834 7743218 ~ 7773892 (-)
AMCG00018344 NA other upstream 907512 8641896 ~ 8648807 (-)
AMCG00018339 NA other upstream 932353 8666737 ~ 8676808 (-)
AMCG00018364 ubald1,LOC105031098,LOC105928896,LOC106589553,LOC103131586 other upstream 1505428 9239812 ~ 9258202 (-)
AMCG00018390 snu13,LOC101154660,LOC105910236 other upstream 2039922 9774306 ~ 9779545 (-)

Expression


Co-expression Network