G116875 (slc29a4,LOC108430547,LOC107104199)


Basic Information

Item Value
gene id G116875
gene name slc29a4,LOC108430547,LOC107104199
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 13330891 ~ 13342748 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU146401
GGTTACCTGTTTGCTCTTGGTCCCCTCCTGTTTGTAAGTGTCTGTGATGTCTGGCTGGAGAAGTTTACCAATAGTCAGTCCTATGCTGTTAACCTGGTGGCTGTTGGGGTTGTGGCGTTTGGATGCACAGTTCAGCAGTCAAGTTTCTATGGGTACACAGGGATGCTTCCAAAGCGGTACACACAAGGCGTGATGACAGGCGAGAG
>TU146402
aatcactgctgGTTACCTGTTTGCTCTTGGTCCCCTCCTGTTTGTAAGTGTCTGTGATGTCTGGCTGGAGAAGTTTACCAATAGTCAGTCCTATGCTGTTAACCTGGTGGCTGTTGGGGTTGTGGCGTTTGGATGCACAGTTCAGCAGTCAAGTTTCTATGGGTACACAGGGATGCTTCCAAAGCGGTACACACAAGGCGTGATGACAGGCGAGAG

Function

symbol description
slc29a4 Enables several functions, including efflux transmembrane transporter activity; monoamine transmembrane transporter activity; and neurotransmitter transmembrane transporter activity. Involved in several processes, including cation transport; export across plasma membrane; and monoamine transport. Part of apical plasma membrane and basolateral plasma membrane.

NR:

description
PREDICTED: equilibrative nucleoside transporter 4 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU146401 False 206 lncRNA 0.50 2 13330891 13331814
TU146402 True 216 lncRNA 0.50 3 13330891 13342748

Neighbor

gene id symbol gene type direction distance location
AMCG00018521 NA coding downstream 85160 13238810 ~ 13245731 (-)
AMCG00018518 NA coding downstream 96207 13227151 ~ 13234684 (-)
AMCG00018517 shmt1,LOC107674655,LOC107581728,LOC107737723,LOC107720052,LOC108257064 coding downstream 107181 13214592 ~ 13223710 (-)
AMCG00018519 NA coding downstream 118296 13203693 ~ 13212595 (-)
AMCG00018512 LOC107674657,LOC107592418,LOC107737959 coding downstream 143142 13160357 ~ 13187749 (-)
AMCG00018524 NA coding upstream 229618 13572366 ~ 13578310 (-)
AMCG00018525 actb,LOC102799139,LOC103365100,LOC102299797 coding upstream 240356 13583104 ~ 13587070 (-)
AMCG00018529 NA coding upstream 401241 13743989 ~ 13745104 (-)
AMCG00018531 smurf1,LOC107720062,LOC107591759,LOC107703417,LOC107581717 coding upstream 441105 13783853 ~ 13832385 (-)
AMCG00018532 NA coding upstream 508663 13851411 ~ 13857590 (-)
G116784 NA non-coding downstream 284298 12989436 ~ 13046593 (-)
G116750 NA non-coding downstream 446469 12879665 ~ 12884422 (-)
G116749 NA non-coding downstream 454128 12874915 ~ 12876763 (-)
G116672 NA non-coding downstream 1032180 12295461 ~ 12298711 (-)
G116619 NA non-coding downstream 1210284 12119808 ~ 12120607 (-)
G116883 NA non-coding upstream 23826 13366574 ~ 13367055 (-)
G116918 NA non-coding upstream 157970 13500718 ~ 13502497 (-)
G116931 NA non-coding upstream 185948 13528696 ~ 13534836 (-)
G116949 NA non-coding upstream 277475 13620223 ~ 13620432 (-)
G117011 arpc1a,LOC107388895,LOC107674705,LOC107703414 non-coding upstream 543561 13886309 ~ 13887367 (-)
AMCG00018522 NA other downstream 73641 13253085 ~ 13257250 (-)
AMCG00018490 NA other downstream 1040347 12287568 ~ 12290544 (-)
G116577 NA other downstream 1419555 11911014 ~ 11911336 (-)
G116428 NA other downstream 2128003 11199578 ~ 11202888 (-)
AMCG00018440 NA other downstream 2183951 11088174 ~ 11146940 (-)
AMCG00018528 LOC104956910,LOC107742399,LOC107591749,LOC106595856 other upstream 302620 13645368 ~ 13727870 (-)
AMCG00018555 LOC107689851 other upstream 899797 14242545 ~ 14263154 (-)
G117267 ywhag,143g1,ywhag1,LOC106603950,LOC108233911,LOC107387033 other upstream 1160655 14503403 ~ 14520875 (-)
G117377 NA other upstream 1393390 14736138 ~ 14738312 (-)
AMCG00018617 ypel1,YPEL1,ypelc,ypel2b,LOC106931471,LOC103374080,LOC108277989,LOC106586007,LOC106940241 other upstream 2155914 15498662 ~ 15518315 (-)

Expression


Co-expression Network