G117441



Basic Information


Item Value
gene id G117441
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 14856420 ~ 14857595 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU147151
AAAACACTTTACACCAGACATGTCTGTTATAAGTATTTATCGGTATTCACCTGTTCAGGAAGTGTGAGATTCGCTAACTGCGCAGTTTATAGTTCCTCCTGGGCGTAACGGCGTAAGGATACACACAGAAGGTATAAATACAAGAGCCCTTTGTTTCGCCGCAAACAGAGCGATTCACAGGGAGAAGTGCACTCGTGTTATCGGCAGAGGACGAAACCGCTCTATATTCCAACATGCAGATCTTCGTGAAGACCTTGACTGGCAAGACCATCACTCTTGAGGTGGAGCCCAGTGACACC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU147151 True 299 lncRNA 0.47 2 14856420 14857595
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00018599 NA coding downstream 6511 14838570 ~ 14849909 (-)
AMCG00018595 NA coding downstream 26254 14824705 ~ 14830166 (-)
AMCG00018594 ctu1 coding downstream 34560 14818783 ~ 14821860 (-)
AMCG00018598 pxn,LOC107748058,LOC107557596,LOC106579946 coding downstream 59055 14784380 ~ 14797365 (-)
AMCG00018596 rplp0 coding downstream 77565 14773974 ~ 14778855 (-)
AMCG00018597 NA coding upstream 2162 14859757 ~ 14871803 (-)
AMCG00018601 NA coding upstream 17156 14874751 ~ 14875404 (-)
AMCG00018607 sept5 coding upstream 23004 14880599 ~ 14885351 (-)
AMCG00018606 LOC106580435,LOC105014311,LOC108265487 coding upstream 42217 14899812 ~ 14923007 (-)
AMCG00018605 cdc45 coding upstream 82179 14939774 ~ 14948267 (-)
G117438 NA non-coding downstream 20695 14833856 ~ 14835725 (-)
G117432 NA non-coding downstream 72107 14780287 ~ 14784313 (-)
G117338 NA non-coding downstream 151962 14703640 ~ 14704458 (-)
G117319 NA non-coding downstream 220081 14635404 ~ 14636339 (-)
G117293 NA non-coding downstream 268370 14578236 ~ 14588050 (-)
G117472 NA non-coding upstream 121446 14979041 ~ 14980384 (-)
G117501 NA non-coding upstream 356573 15214168 ~ 15214431 (-)
G117646 tbx1 non-coding upstream 1165003 16022598 ~ 16025073 (-)
G117710 NA non-coding upstream 1437235 16294830 ~ 16296445 (-)
G117809 NA non-coding upstream 2296407 17154002 ~ 17155261 (-)
G117377 NA other downstream 118108 14736138 ~ 14738312 (-)
G117267 ywhag,143g1,ywhag1,LOC106603950,LOC108233911,LOC107387033 other downstream 335545 14503403 ~ 14520875 (-)
AMCG00018555 LOC107689851 other downstream 593266 14242545 ~ 14263154 (-)
AMCG00018528 LOC104956910,LOC107742399,LOC107591749,LOC106595856 other downstream 1128550 13645368 ~ 13727870 (-)
AMCG00018522 NA other downstream 1599170 13253085 ~ 13257250 (-)
AMCG00018617 ypel1,YPEL1,ypelc,ypel2b,LOC106931471,LOC103374080,LOC108277989,LOC106586007,LOC106940241 other upstream 641067 15498662 ~ 15518315 (-)
G117784 NA other upstream 2151303 17008898 ~ 17009301 (-)
G117823 NA other upstream 2368495 17226090 ~ 17256271 (-)
G117899 NA other upstream 2745761 17603356 ~ 17603848 (-)
G118075 NA other upstream 3608773 18466368 ~ 18474245 (-)

Expression


G117441 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2000.
End of interactive chart.

G117441 Expression in each Bioproject

Bar chart with 7 bars.
G117441 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2500.
End of interactive chart.

Co-expression Network