G117784


Basic Information

Item Value
gene id G117784
gene name NA
gene type unknown
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 17008898 ~ 17009301 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU147593
caccgatcagccataacattatgaccactgacagctgaagtgaataacactgataatctcgttatcatggcacctgtcagtgggtgggatatattaggcagcaagtgaacattttgtcctcaaagttgatgtgttagaagcaggaaaaatgggcaagcgtaaggatctgagcgactttgacaagggccaaattgtgatggctagacgactgggtcagagcatctccaaaactgcagctcttgtggggtgttcccggtctgcagtggtcagtacctatcaaaagtggtccaaggaaggaaaagcagtgaaccggcgacagggtcatgggcggccaaggctcattgatgcacgtggggagcgaaggctggcccgtgtggtccgatccaacagacgagctactgtag

Function

GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU147593 True 404 TUCP 0.51 1 17008898 17009301

Neighbor

gene id symbol gene type direction distance location
AMCG00018649 galnt9,LOC103141400,LOC106920899,LOC106962167 coding downstream 31815 16963043 ~ 16977083 (-)
AMCG00018651 LOC106920899,LOC106940379,LOC107600134 coding downstream 85304 16912767 ~ 16923594 (-)
AMCG00018646 LOC106580457 coding downstream 260937 16747653 ~ 16747961 (-)
AMCG00018645 NA coding downstream 523310 16464741 ~ 16485588 (-)
AMCG00018644 chfr,LOC100195666,LOC106580459,LOC102788874 coding downstream 546535 16438631 ~ 16462363 (-)
AMCG00018650 NA coding upstream 58911 17068212 ~ 17070690 (-)
AMCG00018652 znrf3 coding upstream 146919 17156220 ~ 17168116 (-)
AMCG00018653 znrf3,LOC106584905 coding upstream 169788 17179089 ~ 17224239 (-)
AMCG00018656 NA coding upstream 258288 17267589 ~ 17290539 (-)
AMCG00018658 NA coding upstream 288963 17298264 ~ 17304621 (-)
G117710 NA non-coding downstream 712453 16294830 ~ 16296445 (-)
G117646 tbx1 non-coding downstream 983825 16022598 ~ 16025073 (-)
G117501 NA non-coding downstream 1794467 15214168 ~ 15214431 (-)
G117472 NA non-coding downstream 2028514 14979041 ~ 14980384 (-)
G117441 NA non-coding downstream 2151303 14856420 ~ 14857595 (-)
G117809 NA non-coding upstream 144701 17154002 ~ 17155261 (-)
G117853 NA non-coding upstream 456833 17466134 ~ 17466434 (-)
G117856 NA non-coding upstream 505556 17514857 ~ 17515120 (-)
G117888 NA non-coding upstream 575450 17584751 ~ 17585098 (-)
G117916 NA non-coding upstream 725375 17734676 ~ 17736324 (-)
AMCG00018617 ypel1,YPEL1,ypelc,ypel2b,LOC106931471,LOC103374080,LOC108277989,LOC106586007,LOC106940241 other downstream 1490583 15498662 ~ 15518315 (-)
G117377 NA other downstream 2270586 14736138 ~ 14738312 (-)
G117267 ywhag,143g1,ywhag1,LOC106603950,LOC108233911,LOC107387033 other downstream 2488023 14503403 ~ 14520875 (-)
AMCG00018555 LOC107689851 other downstream 2745744 14242545 ~ 14263154 (-)
AMCG00018528 LOC104956910,LOC107742399,LOC107591749,LOC106595856 other downstream 3281028 13645368 ~ 13727870 (-)
G117823 NA other upstream 216789 17226090 ~ 17256271 (-)
G117899 NA other upstream 594055 17603356 ~ 17603848 (-)
G118075 NA other upstream 1457067 18466368 ~ 18474245 (-)
AMCG00018687 NA other upstream 1529117 18538418 ~ 18547368 (-)
AMCG00018703 triap1,LOC106568193,LOC106564228 other upstream 1735833 18745134 ~ 18746820 (-)

Expression


Co-expression Network