G118624 (pitpnm2)


Basic Information

Item Value
gene id G118624
gene name pitpnm2
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 20517259 ~ 20517494 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU148645
ACCTACATCGTGGATGAACCTCTCAATTTTGGACTGCATGCCCCAGTAGCGGAACTCCACTTTGCAGAGCTTGTACGCGCACATGATGGGCATCTTCCCCGGGTTGTTGTTGAACTCTTCGATCCAGTCCTCTGTCAGCGGGCCCCTCTTTGTCTTGATGGACTTGTACAGCTTGGGGTCCTCCTCAGCCTTGTACTCATGCGGGGGGATGGGGTCCTTCACAATATCGATTGGAT

Function

symbol description
pitpnm2 Enables calcium ion binding activity; phosphatidylinositol transfer activity; and receptor tyrosine kinase binding activity. Involved in phosphatidylinositol-mediated signaling. Predicted to be located in cytosol. Predicted to be active in cytoplasm.

NR:

description
PREDICTED: membrane-associated phosphatidylinositol transfer protein 2 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU148645 True 236 lncRNA 0.53 1 20517259 20517494

Neighbor

gene id symbol gene type direction distance location
AMCG00018782 arl6ip4 coding upstream 32330 20477126 ~ 20484929 (+)
AMCG00018789 NA coding upstream 53910 20457965 ~ 20463349 (+)
AMCG00018783 NA coding upstream 83604 20408073 ~ 20433655 (+)
AMCG00018784 NA coding upstream 118922 20383129 ~ 20398337 (+)
AMCG00018775 NA coding upstream 168317 20322418 ~ 20348942 (+)
AMCG00018793 kmt5a coding downstream 113509 20631003 ~ 20637704 (+)
AMCG00018791 snrnp35,LOC102792111 coding downstream 124835 20642329 ~ 20645241 (+)
AMCG00018799 tmed2,LOC105026094,LOC108425203 coding downstream 153342 20670836 ~ 20678821 (+)
AMCG00018804 NA coding downstream 178188 20695682 ~ 20697892 (+)
AMCG00018803 NA coding downstream 180728 20698222 ~ 20705953 (+)
G118622 NA non-coding upstream 12752 20504116 ~ 20504507 (+)
G118621 LOC107554528,LOC107654556 non-coding upstream 15826 20500950 ~ 20501433 (+)
G118620 NA non-coding upstream 17049 20499674 ~ 20500210 (+)
G118618 NA non-coding upstream 26153 20490861 ~ 20491106 (+)
G118608 NA non-coding upstream 74030 20438960 ~ 20443229 (+)
G118625 pitpnm2 non-coding downstream 5944 20523438 ~ 20523721 (+)
G118626 NA non-coding downstream 19240 20536734 ~ 20576007 (+)
G118630 NA non-coding downstream 68134 20585628 ~ 20590502 (+)
G118633 NA non-coding downstream 73069 20590563 ~ 20591175 (+)
G118631 NA non-coding downstream 73699 20591193 ~ 20591550 (+)
G118623 NA other upstream 2768 20514160 ~ 20514491 (+)
AMCG00018781 denr other upstream 142447 20372219 ~ 20374812 (+)
G118557 NA other upstream 256319 20259377 ~ 20260940 (+)
AMCG00018762 NA other upstream 542529 19971139 ~ 19974730 (+)
AMCG00018740 NA other upstream 1035167 19373472 ~ 19482092 (+)
G118635 NA other downstream 75242 20592736 ~ 20593016 (+)
G118636 NA other downstream 75872 20593366 ~ 20594139 (+)
AMCG00018792 LOC106928543 other downstream 84462 20601956 ~ 20603315 (+)
AMCG00018800 ddx55,gtf2h3,eif2b1 other downstream 161786 20679280 ~ 20695194 (+)
AMCG00018802 dnah10,LOC102798403,LOC105907537,LOC105907538 other downstream 206116 20723610 ~ 20772586 (+)

Expression


Co-expression Network