AMCG00019012



Basic Information


Item Value
gene id AMCG00019012
gene name NA
gene type misc
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 739226 ~ 744083 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00019012
ATGGTCCATCGGGTGCACAAGTTCCCCGCTGAGGCCGTCAACATGAGAGCTCTGATCACAGCCCTGCTCTGCGCCGCCCTCACGCTCAGTGCGCTGGCAGGTAAGGACTGCGCTCGGGACGCTGGGATAGGCGTTAATCGCCTGGACAAAGCGAAGCTGAACGAACGCAGTGTGGTGCACTACGCCACCAGTGACTCTCCCCCAGACAGAACCGGCTTCCTCTATAACAAAGGAGAGCGTAACACGGCCTACCACTGGCGCTGGTTCATCCTGAAGGGTACATGCTGTTCTGCTTCAAGGACAAGGATAGCGTGA
>TU38383
CCAGCCAGTGCTGCCCAGCAACCTCCTCACCCCGCCCCCCCATCTGTGATAAAGAGCTCagctgagagaaagagagacacagagagagacacaaagacaacCACTGAGACACTCTACAGGAGGCCGTCAACATGAGAGCTCTGATCACAGCCCTGCTCTGCGCCGCCCTCACGCTCAGTGCGCTGGCAGACGACGAACACGCAGCGCCTGGACAAAGCGGTG

Function


GO:

id name namespace
GO:0030168 platelet activation biological_process
GO:0007596 blood coagulation biological_process
GO:0050817 coagulation biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00019012 True 315 mRNA 0.58 4 740473 744083
TU38383 False 222 lncRNA 0.60 4 739226 741433

Neighbor


gene id symbol gene type direction distance location
AMCG00019009 NA coding upstream 36980 701324 ~ 702246 (+)
AMCG00019008 NA coding upstream 115879 608775 ~ 623347 (+)
AMCG00019005 NA coding upstream 140028 597828 ~ 599198 (+)
AMCG00019004 gpt,LOC103482433 coding upstream 152963 575957 ~ 586263 (+)
AMCG00018997 NA coding upstream 178629 559335 ~ 560597 (+)
AMCG00019011 NA coding downstream 71 744154 ~ 751040 (+)
AMCG00019013 NA coding downstream 36310 780393 ~ 780629 (+)
AMCG00019017 NA coding downstream 93916 837999 ~ 847327 (+)
AMCG00019016 mafa,LOC107704507 coding downstream 116400 860483 ~ 861397 (+)
AMCG00019021 NA coding downstream 354146 1098229 ~ 1114219 (+)
G30619 NA non-coding upstream 242706 443168 ~ 496520 (+)
G30583 NA non-coding upstream 367428 370446 ~ 371798 (+)
G30549 NA non-coding upstream 457082 227976 ~ 282144 (+)
G30699 NA non-coding downstream 265178 1009261 ~ 1026744 (+)
G30700 NA non-coding downstream 268928 1013011 ~ 1053885 (+)
G30723 NA non-coding downstream 394422 1138505 ~ 1139858 (+)
G30857 NA non-coding downstream 442314 1186397 ~ 1187225 (+)
G30866 NA non-coding downstream 451849 1195932 ~ 1196202 (+)
AMCG00018999 NA other upstream 182322 549516 ~ 556904 (+)
G30589 NA other upstream 340554 395501 ~ 398672 (+)
G30527 NA other upstream 664995 73792 ~ 74231 (+)
G30698 NA other downstream 251244 995327 ~ 1001213 (+)
AMCG00019029 NA other downstream 453903 1197986 ~ 1199095 (+)
AMCG00019030 NA other downstream 469593 1213676 ~ 1237637 (+)
G30877 arhgap39,LOC106560380,LOC106584197 other downstream 509283 1253366 ~ 1253735 (+)
AMCG00019033 NA other downstream 574539 1318622 ~ 1321493 (+)

Expression



Co-expression Network