AMCG00019093 (wnt3a,LOC107661901)


Basic Information

Item Value
gene id AMCG00019093
gene name wnt3a,LOC107661901
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 2758100 ~ 2759745 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00019093
ACCCGGGAGTCTGCTTTCGTCCACGCCATCGCCTCAGCCGGCGTGGCATTCGCGGTGACGCGCTCCTGCGCAGAAGGCTCGGCCACCATCTGCGGCTGCGACACCCGGCACAAGGGCGCCCCCGGGGAGGGCTGGAAGTGGGGTGGCTGCAGCGAGGACGCCGAGTTCGGGAGCATGGTGTCACGGGAGTTCGCGGACGCTCGGGAGAACCGACCTGACGCCCGCTCCGCCATGAACCGCCACAACAACGAGGCCGGGCGCACGTCCATTAACGACCACCTGCACCTCAAGTGCAAGTGCCACGGGCTCTCGGGCAGCTGCGAGGTGAAGACCTGCTGGTGGTCTCAGCCCGACTTCCGTGTGATCGGGGACTACCTGAAGGACAAGTACGACAGCGCCTCGGAGATGGTGGTGGAGAAGCACCGTGAGTCCCGGGGCTGGGTGGAGACGCTCCGGCCCAAGTTCACCTTCTTCAAGCCTCCAACGGAGCGGGATCTGGTCTACTACGAGAGCTCGCCCAACTTCTGCGAGCCCAACCAGGAGACGGGCTCGTTCGGGACCCGGGACCGCGTCTGCAACGTGACGTCCCACGGCATCGATGGCTGCGACCTGCTGTGCTGCGGCCGTGGCCACAACACGAGGACTGAGAAGCGCAAGGAGAAGTGCCACTGCATCTTCCACTGGTGCTGCTATGTCAGCTGCCAGGAGTGCGTGCGCGTCTACGACGTCCACACCTGCAAGTAG

Function

symbol description
wnt3a Predicted to enable cytokine activity and frizzled binding activity. Acts upstream of or within several processes, including chordate embryonic development; post-anal tail morphogenesis; and thalamus development. Predicted to be located in extracellular region. Predicted to be active in extracellular space. Is expressed in several structures, including brain; hindbrain neural rod; neural keel; neural tube; and paraxial mesoderm. Orthologous to human WNT3A (Wnt family member 3A).

NR:

description
PREDICTED: protein Wnt-3a-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00019093 True 744 mRNA 0.65 2 2758100 2759745

Neighbor

gene id symbol gene type direction distance location
AMCG00019091 arf1,arf3,LOC103038497,LOC102781726,LOC107671731 coding downstream 71927 2676315 ~ 2686173 (-)
AMCG00019092 NA coding downstream 100556 2638500 ~ 2657544 (-)
AMCG00019087 NA coding downstream 232971 2520913 ~ 2525129 (-)
AMCG00019085 NA coding downstream 273361 2471464 ~ 2484739 (-)
AMCG00019084 smarcd3,LOC106578675 coding downstream 324025 2409940 ~ 2434075 (-)
AMCG00019094 wnt3a coding upstream 9035 2768780 ~ 2785358 (-)
AMCG00019097 NA coding upstream 318145 3077890 ~ 3094196 (-)
AMCG00019098 NA coding upstream 391085 3150830 ~ 3168130 (-)
AMCG00019102 NA coding upstream 412003 3171748 ~ 3173436 (-)
AMCG00019103 fzd8,fzd8a,LOC106578536,LOC102789550 coding upstream 538593 3298338 ~ 3300086 (-)
G31329 NA non-coding downstream 119980 2635184 ~ 2638120 (-)
G31300 NA non-coding downstream 186812 2566801 ~ 2571288 (-)
G31296 NA non-coding downstream 195306 2561475 ~ 2562794 (-)
G31246 NA non-coding downstream 248906 2500133 ~ 2509194 (-)
G31245 NA non-coding downstream 261533 2494716 ~ 2496567 (-)
G31346 NA non-coding upstream 94703 2854448 ~ 2856659 (-)
G31363 jmjd4,LOC107727496,LOC107661892 non-coding upstream 336964 3096709 ~ 3097340 (-)
G31390 NA non-coding upstream 428982 3188727 ~ 3190187 (-)
G31399 NA non-coding upstream 451659 3211404 ~ 3211605 (-)
G31431 NA non-coding upstream 585112 3344857 ~ 3345240 (-)
G31130 NA other downstream 579450 2177980 ~ 2178650 (-)
G31082 NA other downstream 674829 1932341 ~ 2083271 (-)
AMCG00019059 NA other downstream 861668 1882454 ~ 1896432 (-)
G31035 NA other downstream 1047557 1705899 ~ 1710543 (-)
AMCG00019034 NA other downstream 1434504 1321614 ~ 1323596 (-)
AMCG00019109 NA other upstream 1460698 4220443 ~ 4229991 (-)
AMCG00019129 NA other upstream 2172604 4932349 ~ 4940667 (-)
AMCG00019128 gorasp1,LOC103377203 other upstream 2181314 4941059 ~ 4986384 (-)
AMCG00019165 NA other upstream 3920880 6680625 ~ 6684301 (-)
AMCG00019209 LOC106600477 other upstream 6087406 8847151 ~ 8901878 (-)

Expression


Co-expression Network