AMCG00019159 (crhr2)


Basic Information

Item Value
gene id AMCG00019159
gene name crhr2
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 6311748 ~ 6312120 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00019159
ATGGATGCTACAATGTTTCAAATCTTAATTGGGGAATTTGACCCCAATTGCAGCCTCGTGGATGCTTTCCAGGACACTTTTTATGACAATGCATCTTTTTCTTTCCTGGATTTTGATGGTTTGTATTGCAATGCGACCACGGATGAGATCGGGACCTGCTGGCCGCGGAGCAGCTCGGGGCGGGTGGTGGAGAGACCCTGTCCGGAGTACATCAATGGGGTCAAATACAACACCACCAGTAAGTCCATACGCGGTCTTTAA

Function

symbol description
crhr2 Human ortholog(s) of this gene implicated in asthma. Orthologous to human CRHR2 (corticotropin releasing hormone receptor 2).

NR:

description
PREDICTED: corticotropin-releasing factor receptor 2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00019159 True 261 mRNA 0.49 2 6311748 6312120

Neighbor

gene id symbol gene type direction distance location
AMCG00019156 NA coding upstream 331227 5969442 ~ 5980521 (+)
AMCG00019151 NA coding upstream 626687 5673977 ~ 5685061 (+)
AMCG00019148 NA coding upstream 741212 5566296 ~ 5570536 (+)
AMCG00019147 hhatla,hhatl,LOC107718176,LOC107688529,LOC107722653,LOC107689424 coding upstream 748093 5549593 ~ 5563655 (+)
AMCG00019146 gars,LOC102797257,LOC107591252,LOC103132552 coding upstream 768813 5533680 ~ 5542935 (+)
AMCG00019160 crhr2,LOC102776588,LOC106599903 coding downstream 43140 6355260 ~ 6380345 (+)
AMCG00019162 pth1r,LOC107671674,LOC106599896,LOC107660418 coding downstream 172958 6485078 ~ 6566493 (+)
AMCG00019163 NA coding downstream 294852 6606972 ~ 6668145 (+)
AMCG00019169 NA coding downstream 377795 6689915 ~ 6691084 (+)
AMCG00019167 LOC106569335 coding downstream 392237 6704357 ~ 6705892 (+)
G31879 NA non-coding upstream 48466 6263011 ~ 6263282 (+)
G31877 NA non-coding upstream 48908 6262637 ~ 6262840 (+)
G31874 NA non-coding upstream 122196 6189309 ~ 6189552 (+)
G31873 NA non-coding upstream 123048 6188435 ~ 6188700 (+)
G31872 NA non-coding upstream 124025 6187392 ~ 6187723 (+)
G31893 NA non-coding downstream 105361 6417481 ~ 6417849 (+)
G31894 myl13,myl3,LOC107660402,LOC107567878,LOC107711693,LOC107593749 non-coding downstream 122079 6434199 ~ 6436707 (+)
G31914 NA non-coding downstream 360778 6672898 ~ 6673177 (+)
G31915 NA non-coding downstream 366045 6678165 ~ 6678388 (+)
G31930 NA non-coding downstream 379602 6691722 ~ 6692280 (+)
AMCG00019154 ghrhrb,LOC107704523,LOC106560417,LOC107717144,LOC107556991 other upstream 372151 5930704 ~ 5939597 (+)
AMCG00019111 phlpp1,LOC106599727,LOC103135813,LOC101477421,LOC106925929,LOC102225687,LOC103479552 other upstream 1943545 4319596 ~ 4368203 (+)
AMCG00019100 crem,crema,LOC105019435,LOC106578540,LOC108428923,LOC103396770 other upstream 3100858 3190612 ~ 3210890 (+)
AMCG00019096 LOC107727496 other upstream 3211577 3094452 ~ 3100171 (+)
AMCG00019089 NA other upstream 3693696 2520104 ~ 2618052 (+)
G32005 NA other downstream 1108381 7420501 ~ 7421083 (+)
G32130 itgb1a,LOC107566918,LOC107713907,LOC107734314,LOC107565694,LOC107653806,LOC106590025,LOC104924090,LOC106578567,LOC105019428 other downstream 2033335 8345455 ~ 8384592 (+)
G32286 NA other downstream 2949254 9261374 ~ 9539211 (+)
AMCG00019215 mpp7,LOC107657298,LOC107584397,LOC107721969,LOC104966300 other downstream 3017359 9329479 ~ 9348819 (+)
G32293 armc4 other downstream 3057778 9369898 ~ 9628662 (+)

Expression


Co-expression Network