AMCG00019177 (asic1c,asic3,LOC106930524,LOC106599832,LOC106964295)


Basic Information

Item Value
gene id AMCG00019177
gene name asic1c,asic3,LOC106930524,LOC106599832,LOC106964295
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 7178626 ~ 7179255 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00019177
ATGAAGGGTGACTCAGAGGAAAGCATCGAGAGCATCCGGCCGTCCAACCTGAAGGCGTTCGCCAACACCTCCACCTTGCATGGCATGAGCCACATCTTTGCCTACGGCCCCCTGACCTTCCGCCGCTTCCTCTGGACGCTGTCCTTCCTCGGATCGCTGGGCTTGCTGATGGTCGTCTGCATGGAGCGGATCACCTACTACTTCACCTTCCCGCACGTCACCAAGCTGGACGAGATCGCGGCGACCAACCTCACCTTTCCCGCCATCACCGTCTGCAACCTCAACGAGTTCCGCTTCTCCAAGATCACCCGCAACGACCTGTTCCACGTGGGCGAGCTGCTGGCGCTGCTGAACGAGAACTACCAGATCGCCAACCCCCACCTGGCTGAGCCCGAGGTGCTGGCCGCGCTCAAGGAGAAAGCCAACTTCCACGGCTTCAAGGCCAAGCCCTTCAACATGACCGACTTCTACAACCGCACGGGCCACGACATGGGCGAAATGCTGCTGCAGTGCACCTTCCGCGGAGAGGACTGCTACTCCAGCAACTTCACCACCGTGAGTCTCCACAGGTTTCCTCTCTGCTCCCCTCCAGGCCTGTGCTCATCTGCTGGCGCTGGTGCGTTATTGTGA

Function

symbol description
asic1c Enables ligand-gated sodium channel activity. Predicted to be involved in cellular response to pH; protein homotrimerization; and sodium ion transmembrane transport. Predicted to act upstream of or within sodium ion transport. Is integral component of plasma membrane. Is expressed in gill. Orthologous to human ASIC1 (acid sensing ion channel subunit 1) and ASIC3 (acid sensing ion channel subunit 3).
asic3 Predicted to enable acid-sensing ion channel activity. Involved in sensory perception of sour taste. Predicted to be located in plasma membrane. Predicted to be integral component of plasma membrane.

NR:

description
PREDICTED: acid-sensing ion channel 1-like, partial

GO:

id name namespace
GO:0035725 sodium ion transmembrane transport biological_process
GO:0005887 integral component of plasma membrane cellular_component
GO:0015280 ligand-gated sodium channel activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00019177 True 630 mRNA 0.60 1 7178626 7179255

Neighbor

gene id symbol gene type direction distance location
AMCG00019176 NA coding downstream 164526 7007784 ~ 7014100 (-)
AMCG00019175 asic3,LOC107383864,LOC106964295 coding downstream 214741 6944049 ~ 6963885 (-)
AMCG00019174 atg9b,LOC106599848,LOC107100460,LOC106569346 coding downstream 281073 6869514 ~ 6897553 (-)
AMCG00019170 NA coding downstream 397482 6777404 ~ 6781144 (-)
AMCG00019164 NA coding downstream 500298 6669953 ~ 6678328 (-)
AMCG00019179 NA coding upstream 158592 7337847 ~ 7338238 (-)
AMCG00019183 agap3,LOC107690985,LOC107555304,LOC101174700 coding upstream 241488 7420743 ~ 7422322 (-)
AMCG00019182 agap3 coding upstream 252419 7431674 ~ 7433638 (-)
AMCG00019185 NA coding upstream 266631 7445886 ~ 7470263 (-)
AMCG00019184 agap3,LOC107383869,LOC102197517 coding upstream 300838 7480093 ~ 7499543 (-)
G31933 NA non-coding downstream 486323 6689836 ~ 6692303 (-)
G31932 NA non-coding downstream 489110 6688860 ~ 6689516 (-)
G31931 NA non-coding downstream 490810 6687503 ~ 6687816 (-)
G31882 NA non-coding downstream 913490 6264691 ~ 6265136 (-)
G31878 NA non-coding downstream 915788 6262637 ~ 6262838 (-)
G31993 NA non-coding upstream 45334 7224589 ~ 7224997 (-)
G31997 NA non-coding upstream 111596 7290851 ~ 7291130 (-)
G32037 NA non-coding upstream 236830 7416085 ~ 7419853 (-)
G32057 NA non-coding upstream 494500 7673755 ~ 7687169 (-)
G32061 NA non-coding upstream 523587 7702842 ~ 7703076 (-)
AMCG00019165 NA other downstream 494325 6680625 ~ 6684301 (-)
AMCG00019128 gorasp1,LOC103377203 other downstream 2192242 4941059 ~ 4986384 (-)
AMCG00019129 NA other downstream 2237959 4932349 ~ 4940667 (-)
AMCG00019109 NA other downstream 2948635 4220443 ~ 4229991 (-)
G31130 NA other downstream 4999976 2177980 ~ 2178650 (-)
AMCG00019209 LOC106600477 other upstream 1667896 8847151 ~ 8901878 (-)
AMCG00019213 NA other upstream 2071897 9251152 ~ 9434114 (-)
AMCG00019272 ppp4r1,LOC106579644,LOC106590337 other upstream 4672853 11852108 ~ 11885571 (-)
AMCG00019284 NA other upstream 5233899 12413154 ~ 12423320 (-)
AMCG00019312 NA other upstream 5989181 13168436 ~ 13188292 (-)

Expression


Co-expression Network