AMCG00019181 (gbx1)


Basic Information

Item Value
gene id AMCG00019181
gene name gbx1
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 7400255 ~ 7403144 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00019181
ATGCAGAGACCCAGTGGCCAGGGGACGGCGTTCTCCATCGACTCCCTCATTGGGACCCCACAGCCCCGGTCGGGACACCTGCTCTACACGGGCTACCCCATGTTCATGCCTTACAGACCGCTGGTCATCCCTCAAGCGCTGTCCCACTCGCCGCTGCAGTCGGGCATCCCCCCCTTGGCCCCTTTGGCTTCCTTTGCCGGACGTCTGACCAACACCTTCTGTGCCAGTTTGGGACAGGGGGTCCCGTCCATGGTGGCTCTTACAACGGCGCTGCCCAGTTTCTCCGACCCGCCGGACAGCTTCTACCCGCCGCAGGAGGTCCCTGGACCGCGCCTGAGCGCCGCCGACCCCGGGGTGAGGAGAGCGGAGAGCCCGCATGCCGAGGACCTGCCGGCCCGGGACAAGAGCTCGGAGCTGCTCAACTTCTCGGAAACTTTCCAGACGATCACAGGCGACACCAAACTGTACAGCTCGGATGAGGAGAAACTGGACCTGAAATCCGCCGAGACGCCCAGCAGCGACCGGGAGGAGGACAGCTCCGCCGACAGCGAGAACGAGAGCTTCTCGGACGGCAACACCTGCGGCTCCCTGTTCGCCGTCAGGAGCCAACACCAACAGATAGAGCAAGGGACCCGGCCATGA

Function

symbol description
gbx1 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Acts upstream of or within cerebellum development; midbrain-hindbrain boundary morphogenesis; and regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation. Predicted to be active in nucleus. Is expressed in several structures, including nervous system; neural keel; neural plate; presumptive neural plate; and ventral mesoderm. Orthologous to human GBX1 (gastrulation brain homeobox 1).

NR:

description
homeobox protein GBX-1

GO:

id name namespace
GO:0021555 midbrain-hindbrain boundary morphogenesis biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0060827 regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function

KEGG:

id description
K09321 GBX; homeobox protein GBX

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00019181 True 642 mRNA 0.65 3 7400255 7403144

Neighbor

gene id symbol gene type direction distance location
AMCG00019180 NA coding upstream 5999 7383439 ~ 7394256 (+)
AMCG00019178 NA coding upstream 20583 7359603 ~ 7379672 (+)
AMCG00019173 cdk5,LOC106599847 coding upstream 482874 6908133 ~ 6917381 (+)
AMCG00019172 NA coding upstream 492272 6897818 ~ 6907983 (+)
AMCG00019171 NA coding upstream 567670 6823235 ~ 6832585 (+)
AMCG00019187 tmub1,LOC105023792,LOC102788489 coding downstream 293709 7696853 ~ 7701770 (+)
AMCG00019190 NA coding downstream 308511 7711655 ~ 7712858 (+)
AMCG00019189 NA coding downstream 318696 7721840 ~ 7723326 (+)
AMCG00019188 cul2 coding downstream 335380 7738524 ~ 7760540 (+)
AMCG00019191 NA coding downstream 546354 7949498 ~ 7964176 (+)
G31992 NA non-coding upstream 175258 7224632 ~ 7224997 (+)
G31947 NA non-coding upstream 580220 6819765 ~ 6820035 (+)
G31930 NA non-coding upstream 707975 6691722 ~ 6692280 (+)
G31915 NA non-coding upstream 721867 6678165 ~ 6678388 (+)
G31914 NA non-coding upstream 727078 6672898 ~ 6673177 (+)
G32010 agap3,LOC107383869 non-coding downstream 28536 7431680 ~ 7431944 (+)
G32048 NA non-coding downstream 217360 7620504 ~ 7620812 (+)
G32113 NA non-coding downstream 768501 8171645 ~ 8171861 (+)
G32235 NA non-coding downstream 1492095 8895239 ~ 8933746 (+)
G32268 NA non-coding downstream 1760499 9163643 ~ 9222509 (+)
AMCG00019154 ghrhrb,LOC107704523,LOC106560417,LOC107717144,LOC107556991 other upstream 1460658 5930704 ~ 5939597 (+)
AMCG00019111 phlpp1,LOC106599727,LOC103135813,LOC101477421,LOC106925929,LOC102225687,LOC103479552 other upstream 3032052 4319596 ~ 4368203 (+)
AMCG00019100 crem,crema,LOC105019435,LOC106578540,LOC108428923,LOC103396770 other upstream 4189365 3190612 ~ 3210890 (+)
AMCG00019096 LOC107727496 other upstream 4300084 3094452 ~ 3100171 (+)
AMCG00019089 NA other upstream 4782203 2520104 ~ 2618052 (+)
G32005 NA other downstream 17357 7420501 ~ 7421083 (+)
G32130 itgb1a,LOC107566918,LOC107713907,LOC107734314,LOC107565694,LOC107653806,LOC106590025,LOC104924090,LOC106578567,LOC105019428 other downstream 942311 8345455 ~ 8384592 (+)
G32286 NA other downstream 1858230 9261374 ~ 9539211 (+)
AMCG00019215 mpp7,LOC107657298,LOC107584397,LOC107721969,LOC104966300 other downstream 1926335 9329479 ~ 9348819 (+)
G32293 armc4 other downstream 1966754 9369898 ~ 9628662 (+)

Expression


Co-expression Network