AMCG00019423 (prex2,LOC107566194,LOC107741010,LOC107686687,LOC107758281)


Basic Information

Item Value
gene id AMCG00019423
gene name prex2,LOC107566194,LOC107741010,LOC107686687,LOC107758281
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 19614916 ~ 19625804 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00019423
ATGATGAGGCCTCTCAATGCACTGGACGAGCTGTATCGATTAATGGAGTCTTTCATCAGCTCGAAACGCACGGCGTCCTGCCAGTTCACGGCCTGTGGAGCGTCTGGCGTGGGCCTGCTGTCAGTGGCCTCTGAGCTGTGCAACCGCCTGGGGGCCTGTCACATCATGATGTGCAACAGTGGTGTCCACAGGTGCACCCTGAGCGTTACTCTTGAACAGGCCATCCTGCTGGCAAGGAGCCATGGACTGCCCCCCCGCTGCATCATGCAGGCCACTGATGTCATGAGGAAACAGGGAGCAAGAGTTCAAAACTCAGCCAAGAACCTGGGCGTGAGGGACCGCACCCCCCAGTCTGTTCCC

Function

symbol description
prex2 Predicted to enable guanyl-nucleotide exchange factor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to act upstream of or within intracellular signal transduction. Predicted to be active in plasma membrane. Human ortholog(s) of this gene implicated in Klatskin's tumor. Orthologous to human PREX2 (phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 2).

NR:

description
PREDICTED: phosphatidylinositol 3,4,5-trisphosphate-dependent Rac exchanger 2 protein-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00019423 True 360 mRNA 0.59 3 19614916 19625804

Neighbor

gene id symbol gene type direction distance location
AMCG00019427 prex2,LOC107686687 coding upstream 13276 19536834 ~ 19601640 (+)
AMCG00019414 NA coding upstream 248388 19340246 ~ 19366528 (+)
AMCG00019413 sgk3,LOC107666631,LOC106579527 coding upstream 331184 19269809 ~ 19283732 (+)
AMCG00019407 adhfe1,LOC101480322 coding upstream 413238 19191577 ~ 19201678 (+)
AMCG00019411 rrs1,LOC106579528,LOC107590198 coding upstream 424603 19189279 ~ 19190313 (+)
AMCG00019424 cunh8orf34,zgc:162928,LOC105890107,LOC107741009,LOC107686688,LOC107566197,LOC107758299 coding downstream 36570 19662374 ~ 19665136 (+)
AMCG00019422 zgc:162928,c23h8orf34,LOC105890107,LOC107686688,LOC107758299,LOC107585009,LOC107695418 coding downstream 54964 19680768 ~ 19688614 (+)
AMCG00019426 NA coding downstream 100781 19726585 ~ 19736870 (+)
AMCG00019425 NA coding downstream 221353 19847157 ~ 19877863 (+)
AMCG00019433 NA coding downstream 489520 20115324 ~ 20122534 (+)
G33913 NA non-coding upstream 405206 19207194 ~ 19209710 (+)
G33874 NA non-coding upstream 687629 18927047 ~ 18927287 (+)
G33812 NA non-coding upstream 1031212 18576495 ~ 18583704 (+)
G33810 NA non-coding upstream 1163513 18451133 ~ 18451403 (+)
G33809 NA non-coding upstream 1164075 18450617 ~ 18450841 (+)
G34084 NA non-coding downstream 445532 20071336 ~ 20071564 (+)
G34086 NA non-coding downstream 449374 20075178 ~ 20078454 (+)
G34093 NA non-coding downstream 469514 20095318 ~ 20096450 (+)
G34183 NA non-coding downstream 1007273 20633077 ~ 20635272 (+)
G34192 NA non-coding downstream 1047183 20672987 ~ 20746971 (+)
AMCG00019428 LOC107595150 other upstream 159779 19451247 ~ 19455137 (+)
AMCG00019415 NA other upstream 320708 19285536 ~ 19294208 (+)
AMCG00019402 NA other upstream 593504 19005024 ~ 19021412 (+)
AMCG00019376 NA other upstream 2162257 17449320 ~ 17452659 (+)
G33406 NA other upstream 3532973 16043942 ~ 16081943 (+)
G34170 rpl7 other downstream 981670 20607474 ~ 20610889 (+)
AMCG00019475 march6,LOC105024238,LOC102207159,LOC101475102,LOC102312386,LOC104929871,LOC100690953,LOC102783154,LOC107746911,LOC107686038,LOC107732575 other downstream 2989819 22615623 ~ 22643226 (+)
AMCG00019481 NA other downstream 3560012 23185816 ~ 23204250 (+)
AMCG00019480 NA other downstream 3607466 23233270 ~ 23248099 (+)
G34511 zfhx4,LOC107590192,LOC107721891 other downstream 4046321 23672125 ~ 23695801 (+)

Expression


Co-expression Network