AMCG00019447 (stau2,LOC102777375)


Basic Information

Item Value
gene id AMCG00019447
gene name stau2,LOC102777375
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 20728040 ~ 20730981 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00019447
CTTCTCCCCAGGAAAACATGGCAAACCCCAAAGAGAAAACTCCAATGTGTCTGGTAAATGAGTTAGCCCGTTTCAACAGAATCCAGCCACAGTATAAACTCCTGAATGAACGGGGGCCGGCCCATGCAAAGATCTTCACTGTGCAGCTGGCTCTTGGGGAGCAGACGTGGGAAGCAGAGGGAACCAGCATAAAAAAGGCACAACACTCAACAGCATCCAAGGCCCTGATAGAAAGCAACCTCCCCAGGCCTTCTCCCCGCCCCCCCAAGGTGGACATCAACAGCAACCCAGGCAGTATAACCCCCACAGTAGAGCTGAACGGCCTGGCGATGAAAAGAGGAGAACCCGCGATATACAGACCTCTGGATCCCAAGCCCATGCCCAATTACAGAGCCAACTACAACTTCAGAGGAATGTTTAATCAG

Function

symbol description
stau2 Predicted to enable RNA binding activity. Acts upstream of or within germ cell development and germ cell migration. Predicted to be located in microtubule. Is expressed in midbrain; oocyte; and otic vesicle. Orthologous to human STAU2 (staufen double-stranded RNA binding protein 2).

NR:

description
PREDICTED: double-stranded RNA-binding protein Staufen homolog 2-like

GO:

id name namespace
GO:0007281 germ cell development biological_process
GO:0008354 germ cell migration biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00019447 True 425 mRNA 0.52 3 20728040 20730981

Neighbor

gene id symbol gene type direction distance location
AMCG00019449 stau2,LOC107754214,LOC107560262,LOC107691439 coding downstream 24212 20683262 ~ 20703828 (-)
AMCG00019443 NA coding downstream 128547 20594770 ~ 20599493 (-)
AMCG00019442 NA coding downstream 153424 20564046 ~ 20574616 (-)
AMCG00019439 NA coding downstream 320448 20377818 ~ 20407592 (-)
AMCG00019434 NA coding downstream 374946 20352154 ~ 20353094 (-)
AMCG00019448 TCEB1,tceb1,tceb1b,LOC108426597 coding upstream 40549 20771530 ~ 20776598 (-)
AMCG00019452 NA coding upstream 89735 20820716 ~ 20823757 (-)
AMCG00019451 jph1 coding upstream 131151 20862132 ~ 20869165 (-)
AMCG00019456 NA coding upstream 503787 21234768 ~ 21242674 (-)
AMCG00019457 NA coding upstream 515807 21246788 ~ 21293737 (-)
G34148 NA non-coding downstream 178340 20478257 ~ 20549700 (-)
G34006 NA non-coding downstream 1247072 19467076 ~ 19480968 (-)
G33830 NA non-coding downstream 2112786 18606141 ~ 18615254 (-)
G33765 NA non-coding downstream 2511298 18215608 ~ 18216742 (-)
G33758 rab2a non-coding downstream 2529883 18179089 ~ 18198157 (-)
G34277 NA non-coding upstream 706934 21437915 ~ 21438156 (-)
G34283 LOC102215562 non-coding upstream 815227 21546208 ~ 21546524 (-)
G34468 LOC103376870 non-coding upstream 2387820 23118801 ~ 23120960 (-)
G34476 NA non-coding upstream 2479260 23210241 ~ 23286999 (-)
G34502 NA non-coding upstream 2845546 23576527 ~ 23578285 (-)
AMCG00019419 cpa6,LOC106579545 other downstream 1273071 19442395 ~ 19454969 (-)
AMCG00019417 NA other downstream 1426493 19294812 ~ 19301547 (-)
AMCG00019396 NA other downstream 2286059 18384867 ~ 18441981 (-)
G33381 ube2v2,LOC107732116 other downstream 5006588 15692482 ~ 15721452 (-)
G33259 garem1,LOC107659447,LOC107598699,LOC107684519,LOC107724394 other downstream 5736044 14951842 ~ 14991996 (-)
AMCG00019446 ube2w other upstream 12549 20743530 ~ 20765496 (-)
AMCG00019487 NA other upstream 1939666 22670647 ~ 22744182 (-)
G34470 NA other upstream 2416880 23147861 ~ 23199608 (-)
AMCG00019500 pign other upstream 3321030 24052011 ~ 24094664 (-)
G35067 NA other upstream 8787015 29517996 ~ 29521984 (-)

Expression


Co-expression Network