AMCG00019455 (LOC107092069)


Basic Information

Item Value
gene id AMCG00019455
gene name LOC107092069
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 20952419 ~ 20955046 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00019455
CATCAGTGGAAAGACGAGCCAAAAGCGATGAAGGAAGTCAGGAAGCTGTGCCCGGTGAAAGCGCTGCTCGTATACCTGGCCTGCGGAGCCAGTGCGCTGGTCGTTGCTAATTCCACCGATGCGTTGTCATCAGCCAGCAATTTCACCGACATTGGCTCCGCGTTGAAACACCATCTCGACTCTACGAATATCCCCAAGACTAGACGGAGGCGTTACATCCCCCAAGATGACATCATCGCGATTCTCGATTACCATAATAAAATCCGAGGAAAAGTCTTCCCACCTGCTTCAAACATGGAATACATGGTCTGGGATGAAAATCTTGCCAAATCTGCAGAGGCCTGGGCGGCAACATGTATCTGGGACCATGGTCCTCAGTATCTTCTGAGATTCTTGGGTCAGAACCTGTCTGTTAGAACTGGACGGTAG

Function

NR:

description
PREDICTED: peptidase inhibitor 15-A-like

GO:

id name namespace
GO:0010466 negative regulation of peptidase activity biological_process
GO:0005576 extracellular region cellular_component
GO:0030414 peptidase inhibitor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00019455 True 429 mRNA 0.51 2 20952419 20955046

Neighbor

gene id symbol gene type direction distance location
AMCG00019453 gdap1 coding upstream 73605 20874430 ~ 20878814 (+)
AMCG00019450 NA coding upstream 173503 20777256 ~ 20778916 (+)
AMCG00019441 rdh10,rdh10a coding upstream 326382 20612346 ~ 20626037 (+)
AMCG00019440 NA coding upstream 387139 20555707 ~ 20565280 (+)
AMCG00019444 NA coding upstream 406661 20543587 ~ 20545758 (+)
AMCG00019454 NA coding downstream 22887 20977933 ~ 20989120 (+)
AMCG00019459 dok6,LOC107741641 coding downstream 245817 21200863 ~ 21209681 (+)
AMCG00019460 NA coding downstream 376216 21331262 ~ 21331771 (+)
AMCG00019464 NA coding downstream 935017 21890063 ~ 21893971 (+)
AMCG00019463 NA coding downstream 939831 21894877 ~ 21899711 (+)
G34204 NA non-coding upstream 175803 20771526 ~ 20776616 (+)
G34192 NA non-coding upstream 205448 20672987 ~ 20746971 (+)
G34183 NA non-coding upstream 317147 20633077 ~ 20635272 (+)
G34093 NA non-coding upstream 855969 20095318 ~ 20096450 (+)
G34086 NA non-coding upstream 873965 20075178 ~ 20078454 (+)
G34235 NA non-coding downstream 135098 21090144 ~ 21090416 (+)
G34278 NA non-coding downstream 506636 21461682 ~ 21461891 (+)
G34378 NA non-coding downstream 1620928 22575974 ~ 22577472 (+)
G34432 LOC107584984,LOC108256437,LOC107701635 non-coding downstream 1825185 22780231 ~ 22783116 (+)
G34433 NA non-coding downstream 1833962 22789008 ~ 22789463 (+)
G34170 rpl7 other upstream 341530 20607474 ~ 20610889 (+)
AMCG00019428 LOC107595150 other upstream 1497282 19451247 ~ 19455137 (+)
AMCG00019415 NA other upstream 1658211 19285536 ~ 19294208 (+)
AMCG00019402 NA other upstream 1931007 19005024 ~ 19021412 (+)
AMCG00019376 NA other upstream 3499760 17449320 ~ 17452659 (+)
AMCG00019475 march6,LOC105024238,LOC102207159,LOC101475102,LOC102312386,LOC104929871,LOC100690953,LOC102783154,LOC107746911,LOC107686038,LOC107732575 other downstream 1660577 22615623 ~ 22643226 (+)
AMCG00019481 NA other downstream 2230770 23185816 ~ 23204250 (+)
AMCG00019480 NA other downstream 2278224 23233270 ~ 23248099 (+)
G34511 zfhx4,LOC107590192,LOC107721891 other downstream 2717079 23672125 ~ 23695801 (+)
AMCG00019492 NA other downstream 3090643 24045689 ~ 24086481 (+)

Expression


Co-expression Network