AMCG00019727 (larp4b,LOC106599484)


Basic Information

Item Value
gene id AMCG00019727
gene name larp4b,LOC106599484
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 39733389 ~ 39740243 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00019727
ATGCAGAATCTAAATAGAAATGTCTTGTTGCTTTCAGGTGGGAGTGAGACGCCTGCGACCGATAGTCGGGAGGACCTTCGAGAGCATCTGAAGAAGACTCTAGAGTTCTGCTTATCTCGGCAAGTGGTTGAAAACCTTGCCAGTGACATGTACCTAATCTCTCAGATGGACAGTGACCAGTACGTGCCAATAATGACGGTTGCAAATCTGGACCACGTTAAGAAACTGAGCAGTGATATGGATTTGATTGTCGACGTCTTGAGGTCCTTGCCTTTGGTTCAAGTGGATGAAAAGGGGGAGAAGGTCAGACCAAACCAGAATCGCTGCATTGTCATCCTTAGAGAGGTTCCTGAGTCGACTCCAATGGAGGCAAGTTCATTTTGA

Function

symbol description
larp4b Predicted to enable RNA binding activity. Orthologous to human LARP4B (La ribonucleoprotein 4B).

NR:

description
PREDICTED: la-related protein 4B-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00019727 True 384 mRNA 0.47 3 39733389 39740243

Neighbor

gene id symbol gene type direction distance location
AMCG00019725 NA coding downstream 5099 39710987 ~ 39728290 (-)
AMCG00019721 LOC106599479 coding downstream 363192 39363964 ~ 39370197 (-)
AMCG00019720 NA coding downstream 537556 39195494 ~ 39195833 (-)
AMCG00019719 NA coding downstream 636277 39082102 ~ 39097112 (-)
AMCG00019713 LOC106599471,LOC105920328 coding downstream 744258 38980110 ~ 38989131 (-)
AMCG00019726 idi1,LOC107713854 coding upstream 86112 39826355 ~ 39830587 (-)
AMCG00019734 NA coding upstream 989450 40729693 ~ 40766188 (-)
AMCG00019738 NA coding upstream 1807675 41547918 ~ 41563384 (-)
AMCG00019739 NA coding upstream 1834033 41574276 ~ 41576305 (-)
AMCG00019743 tmx3,zgc:152808 coding upstream 2648737 42388980 ~ 42406310 (-)
G36534 NA non-coding downstream 23861 39706602 ~ 39709528 (-)
G36495 NA non-coding downstream 352681 39379808 ~ 39380708 (-)
G36470 NA non-coding downstream 440016 39245792 ~ 39293373 (-)
G36456 NA non-coding downstream 651410 39078503 ~ 39081979 (-)
G36386 vps41 non-coding downstream 1113732 38618841 ~ 38619657 (-)
G36539 gtpbp4 non-coding upstream 72067 39812310 ~ 39813571 (-)
G36557 NA non-coding upstream 157644 39897887 ~ 39901757 (-)
G36576 NA non-coding upstream 449577 40189820 ~ 40191361 (-)
G36582 NA non-coding upstream 594900 40335143 ~ 40335556 (-)
G36590 NA non-coding upstream 664008 40404251 ~ 40404583 (-)
AMCG00019724 dip2c,dip2ca,LOC106522911,LOC106532211 other downstream 227827 39416887 ~ 39505562 (-)
AMCG00019698 NA other downstream 1623165 37889444 ~ 38110224 (-)
AMCG00019665 NA other downstream 3751853 35934796 ~ 35981536 (-)
G35867 NA other downstream 4677945 35055019 ~ 35055444 (-)
AMCG00019645 NA other downstream 5211119 34510733 ~ 34522270 (-)
AMCG00019731 NA other upstream 229932 39970175 ~ 40123987 (-)
AMCG00019741 NA other upstream 2330819 42071062 ~ 42078932 (-)
G36817 NA other upstream 2803873 42544116 ~ 42544524 (-)
G36862 NA other upstream 2904081 42644324 ~ 42656393 (-)
G36982 NA other upstream 3557988 43298231 ~ 43360906 (-)

Expression


Co-expression Network