G30877 (arhgap39,LOC106560380,LOC106584197)


Basic Information

Item Value
gene id G30877
gene name arhgap39,LOC106560380,LOC106584197
gene type unknown
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 1253366 ~ 1253735 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU38640
TCCATGTGGCGGTAGATGTAGCCCTCCAGGTAGGAGTGGAACTTGGGTGTGGGTGGGAAGAAGCCCAGGCAGATGGCCATGAGCTCCCAGCCGCGCTCCAGGCTGTCGTATCGGAAGTTCTCCGTGGTCTGGCGGCACAGCTGGATGTACAGCTCATCTCGCAGGCCCTGGCAGCTCCAGCCCTTGACTGCCACCTCCAGGGCCACGTTCAGGGGATCGGTCTTGGCCCGCCGGTCGCCCATGTACATCTGGATCAGCTTGAAGATCTCTACCGCTTCCTTCTTGACGCCCCGGTCAGAGGTCATAATCATGGGCTTCTTGATTGACTCGCTGCTCCAGGCCAGCATGTTAGCGATGGACACCTTGCGCC

Function

symbol description
arhgap39 Predicted to enable GTPase activator activity. Predicted to act upstream of or within signal transduction. Predicted to be located in cytoskeleton. Predicted to be active in cytoplasm. Is expressed in brain; central nervous system; and lens. Orthologous to human ARHGAP39 (Rho GTPase activating protein 39).

NR:

description
PREDICTED: rho GTPase-activating protein 39 isoform X4

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU38640 True 370 TUCP 0.61 1 1253366 1253735

Neighbor

gene id symbol gene type direction distance location
AMCG00019020 NA coding upstream 69462 1178120 ~ 1183904 (+)
AMCG00019021 NA coding upstream 139147 1098229 ~ 1114219 (+)
AMCG00019016 mafa,LOC107704507 coding upstream 391969 860483 ~ 861397 (+)
AMCG00019017 NA coding upstream 406039 837999 ~ 847327 (+)
AMCG00019013 NA coding upstream 472737 780393 ~ 780629 (+)
AMCG00019040 NA coding downstream 160875 1414610 ~ 1428982 (+)
AMCG00019041 NA coding downstream 300338 1554073 ~ 1557865 (+)
AMCG00019042 NA coding downstream 309288 1563023 ~ 1581623 (+)
AMCG00019050 NA coding downstream 375090 1628825 ~ 1641050 (+)
AMCG00019052 NA coding downstream 390632 1644367 ~ 1658275 (+)
G30874 NA non-coding upstream 14656 1237876 ~ 1238710 (+)
G30869 NA non-coding upstream 24925 1226829 ~ 1228441 (+)
G30866 NA non-coding upstream 57164 1195932 ~ 1196202 (+)
G30857 NA non-coding upstream 66141 1186397 ~ 1187225 (+)
G30723 NA non-coding upstream 113508 1138505 ~ 1139858 (+)
G30878 NA non-coding downstream 2705 1256440 ~ 1256647 (+)
G30887 NA non-coding downstream 56371 1310106 ~ 1310381 (+)
G30903 NA non-coding downstream 155736 1409471 ~ 1409958 (+)
G30910 NA non-coding downstream 162216 1415951 ~ 1416163 (+)
G30937 NA non-coding downstream 298909 1552644 ~ 1552862 (+)
AMCG00019030 NA other upstream 15729 1213676 ~ 1237637 (+)
AMCG00019029 NA other upstream 54271 1197986 ~ 1199095 (+)
G30698 NA other upstream 252153 995327 ~ 1001213 (+)
AMCG00019012 NA other upstream 509283 739226 ~ 744083 (+)
AMCG00018999 NA other upstream 696462 549516 ~ 556904 (+)
AMCG00019033 NA other downstream 64887 1318622 ~ 1321493 (+)
AMCG00019046 NA other downstream 332090 1585825 ~ 1605545 (+)
AMCG00019064 NA other downstream 608094 1861829 ~ 1885551 (+)
G31110 NA other downstream 888095 2141830 ~ 2147563 (+)
AMCG00019089 NA other downstream 1266369 2520104 ~ 2618052 (+)

Expression


Co-expression Network