G31894 (myl13,myl3,LOC107660402,LOC107567878,LOC107711693,LOC107593749)


Basic Information

Item Value
gene id G31894
gene name myl13,myl3,LOC107660402,LOC107567878,LOC107711693,LOC107593749
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 6434199 ~ 6436707 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU39914
taCTTTTGAAgtactttaattacatttatacagtttCAGAAACAGTATTATGACACGTTGCATTCGAATTGAGACAAGATGAATATTAATCGAAAAAGGTTCGCTGCCTTTTTCAGTGCTATTCACAGTTGAAGGTACAAATCGGAGAAAAGAATTACAGAAAGCCTAAAGGTTATGTCCCGATATGAGATTTACAGACGTCTTGATGCCCCGATCTATCCTGCCATGATGTGCTTGACAAACGCTTCATAGTTTATGCATCCATTGGCGTCTTCTTGGCCCACCATGAGTTGATCAACCTCATCttctctcattttctctcCCAGTGTGGCCAGCACGTGGCGCAGCTCAGCGCCCATCACTGTGCCGTTCCCCTCCTTATCGAACACCCTCAGTCCCTCCACAAAGTCCTCGAAGGTGCCCCGATCCTTGGCCTTGCAGATGTGTTGGTGCATGGGCAAGAACGTCTCAAAGTCCATCATTTTGGAGTTCATTTCTGTGAACGGGAGTTGGGGGATGTCACAAAAGGTAGCGTTGACCGGTAACAAGGCATAATCATGACATCTCACTTCCG
>TU39915
TGTCCTACTGCTGTCCCCACACAGGAGATGTGCATTGCGCTTCTTACCCAGTGTGGCCAGCACGTGGCGCAGCTCAGCGCCCATCACTGTGCCGTTCCCCTCCTTATCGAACACCCTCAGTCCCTCCACAAAGTCCTCGAAGGTGCCCCGATCCTTGGCCTTGCAGATGTGTTGGTGCATGGGCAAGAACGTCTCAAAGTCCATCATTTTGGAGTTCATTTCTTCTGCCTTCGGGCTGCCCAGCACCTTCATGACCTCGGCGTTGGTCGGGTTCTG

Function

symbol description
myl13 Predicted to enable calcium ion binding activity. Is expressed in adaxial cell; heart; musculature system; and somite. Human ortholog(s) of this gene implicated in hypertrophic cardiomyopathy 8. Orthologous to human MYL3 (myosin light chain 3).
myl3 Enables actin monomer binding activity. Involved in several processes, including cardiac muscle contraction; regulation of the force of heart contraction; and ventricular cardiac muscle tissue morphogenesis. Located in A band and I band. Implicated in hypertrophic cardiomyopathy 8.

NR:

description
PREDICTED: myosin light chain 4-like isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU39914 True 574 lncRNA 0.45 4 6434199 6435989
TU39915 False 276 lncRNA 0.57 2 6435691 6436707

Neighbor

gene id symbol gene type direction distance location
AMCG00019160 crhr2,LOC102776588,LOC106599903 coding upstream 53854 6355260 ~ 6380345 (+)
AMCG00019159 crhr2 coding upstream 122079 6311748 ~ 6312120 (+)
AMCG00019156 NA coding upstream 453678 5969442 ~ 5980521 (+)
AMCG00019151 NA coding upstream 749138 5673977 ~ 5685061 (+)
AMCG00019148 NA coding upstream 863663 5566296 ~ 5570536 (+)
AMCG00019162 pth1r,LOC107671674,LOC106599896,LOC107660418 coding downstream 48371 6485078 ~ 6566493 (+)
AMCG00019163 NA coding downstream 170265 6606972 ~ 6668145 (+)
AMCG00019169 NA coding downstream 253208 6689915 ~ 6691084 (+)
AMCG00019167 LOC106569335 coding downstream 267650 6704357 ~ 6705892 (+)
AMCG00019168 NA coding downstream 332536 6769243 ~ 6770217 (+)
G31893 NA non-coding upstream 16350 6417481 ~ 6417849 (+)
G31879 NA non-coding upstream 170917 6263011 ~ 6263282 (+)
G31877 NA non-coding upstream 171359 6262637 ~ 6262840 (+)
G31874 NA non-coding upstream 244647 6189309 ~ 6189552 (+)
G31873 NA non-coding upstream 245499 6188435 ~ 6188700 (+)
G31914 NA non-coding downstream 236191 6672898 ~ 6673177 (+)
G31915 NA non-coding downstream 241458 6678165 ~ 6678388 (+)
G31930 NA non-coding downstream 255015 6691722 ~ 6692280 (+)
G31947 NA non-coding downstream 383058 6819765 ~ 6820035 (+)
G31992 NA non-coding downstream 787925 7224632 ~ 7224997 (+)
AMCG00019154 ghrhrb,LOC107704523,LOC106560417,LOC107717144,LOC107556991 other upstream 494602 5930704 ~ 5939597 (+)
AMCG00019111 phlpp1,LOC106599727,LOC103135813,LOC101477421,LOC106925929,LOC102225687,LOC103479552 other upstream 2065996 4319596 ~ 4368203 (+)
AMCG00019100 crem,crema,LOC105019435,LOC106578540,LOC108428923,LOC103396770 other upstream 3223309 3190612 ~ 3210890 (+)
AMCG00019096 LOC107727496 other upstream 3334028 3094452 ~ 3100171 (+)
AMCG00019089 NA other upstream 3816147 2520104 ~ 2618052 (+)
G32005 NA other downstream 983794 7420501 ~ 7421083 (+)
G32130 itgb1a,LOC107566918,LOC107713907,LOC107734314,LOC107565694,LOC107653806,LOC106590025,LOC104924090,LOC106578567,LOC105019428 other downstream 1908748 8345455 ~ 8384592 (+)
G32286 NA other downstream 2824667 9261374 ~ 9539211 (+)
AMCG00019215 mpp7,LOC107657298,LOC107584397,LOC107721969,LOC104966300 other downstream 2892772 9329479 ~ 9348819 (+)
G32293 armc4 other downstream 2933191 9369898 ~ 9628662 (+)

Expression


Co-expression Network