G31947


Basic Information

Item Value
gene id G31947
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 6819765 ~ 6820035 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU39986
aaattcaatgtggacaagtgcaagctattacatgcaggtaacagaaatgtccactataattacactatgggaggaatagaactagatgaagtaacgcatgagaaagacctaggagtctatgtggactcctcactttctccatccaaacaatgtggagaagcaataaaaaaaggcaaacaggatgttagggtatattgtcaaaagtgtagaattgagaacaagggcagtgatgttcagactgtacaatgcgctagttagagctcatctggat

Function

GO:

id name namespace
GO:0071826 ribonucleoprotein complex subunit organization biological_process
GO:0022618 ribonucleoprotein complex assembly biological_process
GO:0006376 mRNA splice site selection biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0000245 spliceosomal complex assembly biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU39986 True 271 lncRNA 0.39 1 6819765 6820035

Neighbor

gene id symbol gene type direction distance location
AMCG00019168 NA coding upstream 49548 6769243 ~ 6770217 (+)
AMCG00019167 LOC106569335 coding upstream 113873 6704357 ~ 6705892 (+)
AMCG00019169 NA coding upstream 128681 6689915 ~ 6691084 (+)
AMCG00019163 NA coding upstream 151620 6606972 ~ 6668145 (+)
AMCG00019162 pth1r,LOC107671674,LOC106599896,LOC107660418 coding upstream 253272 6485078 ~ 6566493 (+)
AMCG00019171 NA coding downstream 3200 6823235 ~ 6832585 (+)
AMCG00019172 NA coding downstream 77783 6897818 ~ 6907983 (+)
AMCG00019173 cdk5,LOC106599847 coding downstream 88098 6908133 ~ 6917381 (+)
AMCG00019178 NA coding downstream 539568 7359603 ~ 7379672 (+)
AMCG00019180 NA coding downstream 563404 7383439 ~ 7394256 (+)
G31930 NA non-coding upstream 127485 6691722 ~ 6692280 (+)
G31915 NA non-coding upstream 141377 6678165 ~ 6678388 (+)
G31914 NA non-coding upstream 146588 6672898 ~ 6673177 (+)
G31894 myl13,myl3,LOC107660402,LOC107567878,LOC107711693,LOC107593749 non-coding upstream 383058 6434199 ~ 6436707 (+)
G31893 NA non-coding upstream 401916 6417481 ~ 6417849 (+)
G31992 NA non-coding downstream 404597 7224632 ~ 7224997 (+)
G32010 agap3,LOC107383869 non-coding downstream 611645 7431680 ~ 7431944 (+)
G32048 NA non-coding downstream 800469 7620504 ~ 7620812 (+)
G32113 NA non-coding downstream 1351610 8171645 ~ 8171861 (+)
G32235 NA non-coding downstream 2075204 8895239 ~ 8933746 (+)
AMCG00019154 ghrhrb,LOC107704523,LOC106560417,LOC107717144,LOC107556991 other upstream 880168 5930704 ~ 5939597 (+)
AMCG00019111 phlpp1,LOC106599727,LOC103135813,LOC101477421,LOC106925929,LOC102225687,LOC103479552 other upstream 2451562 4319596 ~ 4368203 (+)
AMCG00019100 crem,crema,LOC105019435,LOC106578540,LOC108428923,LOC103396770 other upstream 3608875 3190612 ~ 3210890 (+)
AMCG00019096 LOC107727496 other upstream 3719594 3094452 ~ 3100171 (+)
AMCG00019089 NA other upstream 4201713 2520104 ~ 2618052 (+)
G32005 NA other downstream 600466 7420501 ~ 7421083 (+)
G32130 itgb1a,LOC107566918,LOC107713907,LOC107734314,LOC107565694,LOC107653806,LOC106590025,LOC104924090,LOC106578567,LOC105019428 other downstream 1525420 8345455 ~ 8384592 (+)
G32286 NA other downstream 2441339 9261374 ~ 9539211 (+)
AMCG00019215 mpp7,LOC107657298,LOC107584397,LOC107721969,LOC104966300 other downstream 2509444 9329479 ~ 9348819 (+)
G32293 armc4 other downstream 2549863 9369898 ~ 9628662 (+)

Expression


Co-expression Network