G32778



Basic Information


Item Value
gene id G32778
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 12000963 ~ 12001164 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU41061
ctggcacctccctacctaaaagatctccttatcgaatacactccaggtcggccattgagatcacaggaagccggttacttagcgctccctaaaatacacaagaaaagcgcaggtggtagagcattcagttatagggccccgaagctgtggaacgatcttccagccaatgtaagagatgccccctctgtcttagcctttaaat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU41061 True 202 lncRNA 0.49 1 12000963 12001164
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00019274 vapa,LOC102777368 coding upstream 70280 11924765 ~ 11930683 (+)
AMCG00019273 LOC107750901 coding upstream 99887 11888005 ~ 11901076 (+)
AMCG00019268 ralbp1,LOC107667860 coding upstream 133953 11860876 ~ 11867010 (+)
AMCG00019270 LOC106579643,LOC108432738,LOC108271222,LOC103038715 coding upstream 147684 11841143 ~ 11853279 (+)
AMCG00019269 ankrd12 coding upstream 162203 11821023 ~ 11838760 (+)
AMCG00019275 napg,LOC108271818,LOC106590336,LOC108431250 coding downstream 61258 12062422 ~ 12067044 (+)
AMCG00019276 NA coding downstream 66437 12067601 ~ 12075103 (+)
AMCG00019285 NA coding downstream 285754 12286918 ~ 12287709 (+)
AMCG00019281 gnal,LOC107554377,LOC107732066,LOC107667176,LOC106520735 coding downstream 323107 12324271 ~ 12325838 (+)
AMCG00019282 gnal,LOC103396682,LOC106520735 coding downstream 406214 12407378 ~ 12412273 (+)
G32674 NA non-coding upstream 363083 11632358 ~ 11637880 (+)
G32671 NA non-coding upstream 552712 11377956 ~ 11448251 (+)
G32549 LOC103376870 non-coding upstream 1492900 10463163 ~ 10508063 (+)
G32490 NA non-coding upstream 1891813 10108906 ~ 10109150 (+)
G32437 apbb1ip non-coding upstream 2080927 9917320 ~ 9920036 (+)
G32892 NA non-coding downstream 608237 12609401 ~ 12612533 (+)
G32893 NA non-coding downstream 612121 12613285 ~ 12613926 (+)
G33075 LOC104962440 non-coding downstream 1310250 13311414 ~ 13311742 (+)
G33093 NA non-coding downstream 1632538 13633702 ~ 13638171 (+)
G33141 cdh2,LOC102201754,LOC101473079,LOC102787731,LOC103371087 non-coding downstream 2151638 14152802 ~ 14160703 (+)
G32539 NA other upstream 1591466 10404639 ~ 10409497 (+)
G32293 armc4 other upstream 2372301 9369898 ~ 9628662 (+)
G32286 NA other upstream 2461752 9261374 ~ 9539211 (+)
AMCG00019215 mpp7,LOC107657298,LOC107584397,LOC107721969,LOC104966300 other upstream 2652144 9329479 ~ 9348819 (+)
G32130 itgb1a,LOC107566918,LOC107713907,LOC107734314,LOC107565694,LOC107653806,LOC106590025,LOC104924090,LOC106578567,LOC105019428 other upstream 3616371 8345455 ~ 8384592 (+)
G33159 LOC103376870 other downstream 2438089 14439253 ~ 14486706 (+)
G33283 NA other downstream 3163184 15164348 ~ 15169841 (+)
AMCG00019345 NA other downstream 3553655 15554819 ~ 15626955 (+)
G33406 NA other downstream 4042778 16043942 ~ 16081943 (+)
AMCG00019376 NA other downstream 5448156 17449320 ~ 17452659 (+)

Expression


G32778 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G32778 Expression in each Bioproject

Bar chart with 4 bars.
G32778 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network