G33161



Basic Information


Item Value
gene id G33161
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 14491892 ~ 14492206 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU41557
gtagttctgggctgattcctcaccaggtgagatcttgcatggagccccagaccgagggagactgacagttattttgtgtttcttccatttgtgaataatcgcaccaactgttgtcaccttctcaccaagctgcttggcgatggtcttgtagcccattccagccttgtgtaggtctacaatcttgtccctgacatccttggacagctctttggtcttggccatggtggagagtttggaatctgattgattgattgcttctgtggacaggtgtcttttatacaggtaacaa

Function


GO:

id name namespace
GO:0030168 platelet activation biological_process
GO:0007596 blood coagulation biological_process
GO:0050817 coagulation biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection

RNA


RNA id representative length rna type GC content exon number start site end site
TU41557 True 289 lncRNA 0.47 2 14491892 14492206
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00019316 NA coding upstream 817140 13670253 ~ 13674752 (+)
AMCG00019314 psma8,LOC100304914,LOC103029839,LOC105907112,LOC105011885,LOC107572146,LOC102789190 coding upstream 825315 13662222 ~ 13666577 (+)
AMCG00019306 NA coding upstream 1181070 13292718 ~ 13310822 (+)
AMCG00019309 NA coding upstream 1255066 13214956 ~ 13236826 (+)
AMCG00019308 NA coding upstream 1329830 13153820 ~ 13162062 (+)
AMCG00019322 NA coding downstream 180767 14672973 ~ 14698199 (+)
AMCG00019321 NA coding downstream 222599 14714805 ~ 14720892 (+)
AMCG00019325 NA coding downstream 404619 14896825 ~ 14901846 (+)
AMCG00019331 NA coding downstream 411136 14903342 ~ 14907478 (+)
AMCG00019324 NA coding downstream 421819 14914025 ~ 14927971 (+)
G33153 NA non-coding upstream 205876 14285565 ~ 14286016 (+)
G33141 cdh2,LOC102201754,LOC101473079,LOC102787731,LOC103371087 non-coding upstream 331189 14152802 ~ 14160703 (+)
G33093 NA non-coding upstream 853721 13633702 ~ 13638171 (+)
G33075 LOC104962440 non-coding upstream 1180150 13311414 ~ 13311742 (+)
G32893 NA non-coding upstream 1877966 12613285 ~ 12613926 (+)
G33307 NA non-coding downstream 991872 15484078 ~ 15533196 (+)
G33392 NA non-coding downstream 1436363 15928569 ~ 15931201 (+)
G33404 NA non-coding downstream 1510590 16002796 ~ 16003201 (+)
G33408 NA non-coding downstream 1608752 16100958 ~ 16101159 (+)
G33422 NA non-coding downstream 1873908 16366114 ~ 16366342 (+)
G33159 LOC103376870 other upstream 5186 14439253 ~ 14486706 (+)
G32539 NA other upstream 4082395 10404639 ~ 10409497 (+)
G32293 armc4 other upstream 4863230 9369898 ~ 9628662 (+)
G32286 NA other upstream 4952681 9261374 ~ 9539211 (+)
AMCG00019215 mpp7,LOC107657298,LOC107584397,LOC107721969,LOC104966300 other upstream 5143073 9329479 ~ 9348819 (+)
G33283 NA other downstream 672142 15164348 ~ 15169841 (+)
AMCG00019345 NA other downstream 1062613 15554819 ~ 15626955 (+)
G33406 NA other downstream 1551736 16043942 ~ 16081943 (+)
AMCG00019376 NA other downstream 2957114 17449320 ~ 17452659 (+)
AMCG00019402 NA other downstream 4512818 19005024 ~ 19021412 (+)

Expression


G33161 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 150.
End of interactive chart.

G33161 Expression in each Bioproject

Bar chart with 3 bars.
G33161 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 175.
End of interactive chart.

Co-expression Network