G34093


Basic Information

Item Value
gene id G34093
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 20095318 ~ 20096450 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU42682
CCTCATGATGTCTCTGCAGATATCAGCAATGCCCCCGGTATGGTCACTGTGCCAGTGTGTGACTATTATCTCTTGTATGGTGGCATTGAACTGGGTCAGAGCTTGTTTTAAGCAAGTGATGTACTCAGGAACTGAGGGCTCTCCAGTGTCTATCAGCACTCGTCTTTTCCCGTTCCCACTAAGTATGTATTAGTTCCCTGCAGAGTCATAGGCCCGGGGTTGCAACCGAGGATTCGTATCACACGGGAAGACAACTGTTCAATACGAGGGATAATGGCCGCCATTTCTCCCTGTTTTCTTCCAACAAAGGCAACTTTGCAGAGATTTCCTCGTCCTTCCTGAGCTTAACTGCGACGTGTTTAACTTGATGTCTCACGGGTTGCTCTTTCACCACAGACAGCGCAGCAGGACTCGCGTTGCAGGAGGAACTCGCTCAAGTCGAGACACAACAGCGC

Function

NR:

description
ras and EF-hand domain-containing protein-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU42682 True 455 lncRNA 0.50 2 20095318 20096450

Neighbor

gene id symbol gene type direction distance location
AMCG00019425 NA coding upstream 217455 19847157 ~ 19877863 (+)
AMCG00019426 NA coding upstream 358448 19726585 ~ 19736870 (+)
AMCG00019422 zgc:162928,c23h8orf34,LOC105890107,LOC107686688,LOC107758299,LOC107585009,LOC107695418 coding upstream 406704 19680768 ~ 19688614 (+)
AMCG00019424 cunh8orf34,zgc:162928,LOC105890107,LOC107741009,LOC107686688,LOC107566197,LOC107758299 coding upstream 430182 19662374 ~ 19665136 (+)
AMCG00019423 prex2,LOC107566194,LOC107741010,LOC107686687,LOC107758281 coding upstream 469514 19614916 ~ 19625804 (+)
AMCG00019433 NA coding downstream 18874 20115324 ~ 20122534 (+)
AMCG00019445 kcnb2,LOC108426548,LOC107657825,LOC107560266 coding downstream 366873 20463323 ~ 20463886 (+)
AMCG00019444 NA coding downstream 447137 20543587 ~ 20545758 (+)
AMCG00019440 NA coding downstream 459257 20555707 ~ 20565280 (+)
AMCG00019441 rdh10,rdh10a coding downstream 515896 20612346 ~ 20626037 (+)
G34086 NA non-coding upstream 16864 20075178 ~ 20078454 (+)
G34084 NA non-coding upstream 23754 20071336 ~ 20071564 (+)
G33913 NA non-coding upstream 885608 19207194 ~ 19209710 (+)
G33874 NA non-coding upstream 1168031 18927047 ~ 18927287 (+)
G33812 NA non-coding upstream 1511614 18576495 ~ 18583704 (+)
G34183 NA non-coding downstream 536627 20633077 ~ 20635272 (+)
G34192 NA non-coding downstream 576537 20672987 ~ 20746971 (+)
G34204 NA non-coding downstream 675076 20771526 ~ 20776616 (+)
G34235 NA non-coding downstream 993694 21090144 ~ 21090416 (+)
G34278 NA non-coding downstream 1365232 21461682 ~ 21461891 (+)
AMCG00019428 LOC107595150 other upstream 640181 19451247 ~ 19455137 (+)
AMCG00019415 NA other upstream 801110 19285536 ~ 19294208 (+)
AMCG00019402 NA other upstream 1073906 19005024 ~ 19021412 (+)
AMCG00019376 NA other upstream 2642659 17449320 ~ 17452659 (+)
G33406 NA other upstream 4013375 16043942 ~ 16081943 (+)
G34170 rpl7 other downstream 511024 20607474 ~ 20610889 (+)
AMCG00019475 march6,LOC105024238,LOC102207159,LOC101475102,LOC102312386,LOC104929871,LOC100690953,LOC102783154,LOC107746911,LOC107686038,LOC107732575 other downstream 2519173 22615623 ~ 22643226 (+)
AMCG00019481 NA other downstream 3089366 23185816 ~ 23204250 (+)
AMCG00019480 NA other downstream 3136820 23233270 ~ 23248099 (+)
G34511 zfhx4,LOC107590192,LOC107721891 other downstream 3575675 23672125 ~ 23695801 (+)

Expression


Co-expression Network