G35014



Basic Information


Item Value
gene id G35014
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 28949967 ~ 28950230 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU43778
cctctggtttgaagtggtcgatgcctttcatgattttgaagacttgaatcaagtccccacgtagtctcctctgttccagggtgaaaaggttcagttcctcagtctctcagtaggacattcccttcagacctggaataagtctggttgctctcctctgaactgcctctagagcagcgatatctttcttgaagtgtggagcccagaactgcacacagtatccagatgagctctaactagtgcattgtacagtctgaacatcactgc

Function


GO:

id name namespace
GO:0042326 negative regulation of phosphorylation biological_process

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU43778 True 264 lncRNA 0.47 1 28949967 28950230

Neighbor


gene id symbol gene type direction distance location
AMCG00019541 NA coding downstream 123376 28718080 ~ 28826591 (-)
AMCG00019536 drosha,rnasen,LOC107556767 coding downstream 238365 28660017 ~ 28711602 (-)
AMCG00019527 NA coding downstream 1570038 27353217 ~ 27379929 (-)
AMCG00019525 NA coding downstream 3310940 25631697 ~ 25639027 (-)
AMCG00019524 LOC105920200 coding downstream 3336838 25604902 ~ 25613129 (-)
AMCG00019540 NA coding upstream 205107 29155337 ~ 29155822 (-)
AMCG00019539 NA coding upstream 298334 29248564 ~ 29260695 (-)
AMCG00019543 NA coding upstream 328567 29278797 ~ 29300537 (-)
AMCG00019545 NA coding upstream 453111 29403341 ~ 29403998 (-)
AMCG00019544 NA coding upstream 453833 29404063 ~ 29405022 (-)
G35002 NA non-coding downstream 124299 28825320 ~ 28825668 (-)
G34968 NA non-coding downstream 302700 28640232 ~ 28647267 (-)
G34933 NA non-coding downstream 737578 28212139 ~ 28212389 (-)
G34931 NA non-coding downstream 755968 28192767 ~ 28193999 (-)
G34929 NA non-coding downstream 982577 27967154 ~ 27967390 (-)
G35083 NA non-coding upstream 681964 29632194 ~ 29633736 (-)
G35111 NA non-coding upstream 768115 29718345 ~ 29731767 (-)
G35129 NA non-coding upstream 821356 29771586 ~ 29772192 (-)
G35144 NA non-coding upstream 876427 29826657 ~ 29828650 (-)
G35145 NA non-coding upstream 897414 29847644 ~ 29847858 (-)
AMCG00019500 pign other downstream 4855303 24052011 ~ 24094664 (-)
G34470 NA other downstream 5750359 23147861 ~ 23199608 (-)
AMCG00019487 NA other downstream 6205785 22670647 ~ 22744182 (-)
AMCG00019446 ube2w other downstream 8184471 20743530 ~ 20765496 (-)
AMCG00019419 cpa6,LOC106579545 other downstream 9494998 19442395 ~ 19454969 (-)
G35067 NA other upstream 567766 29517996 ~ 29521984 (-)
AMCG00019556 NA other upstream 585514 29535744 ~ 29550162 (-)
AMCG00019554 zgc:56676,eif1b,LOC106578512,LOC105910901,LOC107657782,LOC105027100,LOC107396491 other upstream 688336 29638566 ~ 29645963 (-)
G35101 NA other upstream 728999 29679229 ~ 29685302 (-)
AMCG00019597 NA other upstream 2471799 31422029 ~ 31427583 (-)

Expression



Co-expression Network