G35304



Basic Information


Item Value
gene id G35304
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 31037124 ~ 31037337 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU44140
cttggaacagaggagactacgtggggacttgattcaagtcttcaaaatcatgaaaggcatcgaccacatcaaaccagaggagcttttccagatcagcagggacacacgcacccggggacacaaatggaaattggtcttcaaggcattcaagacagaaaacaggagacacttcttcacacagagaggcgtcacaatctgaacaaactccccagcg

Function


NR:

description
ribose-phosphate pyrophosphokinase 1-like isoform X2

GO: NA

KEGG:

id description
ko04612 Antigen processing and presentation

RNA


RNA id representative length rna type GC content exon number start site end site
TU44140 True 214 lncRNA 0.49 1 31037124 31037337

Neighbor


gene id symbol gene type direction distance location
AMCG00019584 adcy1,LOC103399855,LOC105011947 coding downstream 57178 30947707 ~ 30979946 (-)
AMCG00019583 LOC103354709,LOC102798054 coding downstream 117950 30908864 ~ 30919174 (-)
AMCG00019582 NA coding downstream 142340 30876251 ~ 30894784 (-)
AMCG00019581 NA coding downstream 179257 30854938 ~ 30857867 (-)
AMCG00019576 NA coding downstream 407569 30628722 ~ 30629555 (-)
AMCG00019585 NA coding upstream 34839 31072176 ~ 31078281 (-)
AMCG00019590 NA coding upstream 222472 31259809 ~ 31289751 (-)
AMCG00019592 NA coding upstream 279325 31316662 ~ 31340999 (-)
AMCG00019598 NA coding upstream 391984 31429321 ~ 31432563 (-)
AMCG00019596 NA coding upstream 418791 31456128 ~ 31467641 (-)
G35243 NA non-coding downstream 362241 30592941 ~ 30674883 (-)
G35214 NA non-coding downstream 516660 30507070 ~ 30520464 (-)
G35190 NA non-coding downstream 594534 30412198 ~ 30442590 (-)
G35157 gmds,LOC107721371,LOC107556133 non-coding downstream 910794 30081650 ~ 30126330 (-)
G35145 NA non-coding downstream 1189266 29847644 ~ 29847858 (-)
G35397 mak,ick non-coding upstream 370645 31407982 ~ 31410657 (-)
G35448 NA non-coding upstream 709288 31746625 ~ 31746866 (-)
G35458 NA non-coding upstream 1034720 32072057 ~ 32072286 (-)
G35471 NA non-coding upstream 1144687 32182024 ~ 32183570 (-)
G35481 NA non-coding upstream 1248079 32285416 ~ 32285686 (-)
G35101 NA other downstream 1351822 29679229 ~ 29685302 (-)
AMCG00019554 zgc:56676,eif1b,LOC106578512,LOC105910901,LOC107657782,LOC105027100,LOC107396491 other downstream 1391161 29638566 ~ 29645963 (-)
AMCG00019556 NA other downstream 1486962 29535744 ~ 29550162 (-)
G35067 NA other downstream 1515140 29517996 ~ 29521984 (-)
AMCG00019500 pign other downstream 6942460 24052011 ~ 24094664 (-)
AMCG00019597 NA other upstream 384692 31422029 ~ 31427583 (-)
G35476 LOC107575789 other upstream 1184727 32222064 ~ 32233398 (-)
AMCG00019645 NA other upstream 3473396 34510733 ~ 34522270 (-)
G35867 NA other upstream 4017682 35055019 ~ 35055444 (-)
AMCG00019665 NA other upstream 4897459 35934796 ~ 35981536 (-)

Expression



Co-expression Network