G36539 (gtpbp4)



Basic Information


Item Value
gene id G36539
gene name gtpbp4
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 39812310 ~ 39813571 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU45684
ATCAAATCTGCATAAAAAGGATGGATATCATCCAGTTTGGGGAAGTCGGTGAGAATCTGGGAGAGTCTGTCATGATAGTTCTGCTGTGTGTATTTCACCTTTCTCATATAGAAATGGCGAATGCGATGGATTTGATAGTGCTTATGGATAACCGTGGGAGTCTTCCTTTGCGTCTTGGACAAGGTAATATCTATAAATTCCTTTGCGGTGGGAACCACCATAATCTTCTTGAAATTGTACAGAGCCATCTTTCCCTTCCACGCTGCTCGCTTCTCCT

Function


symbol description
gtpbp4 Predicted to enable GTP binding activity. Predicted to act upstream of or within ribosome biogenesis. Predicted to be located in nucleolus. Is expressed in gill. Orthologous to human GTPBP4 (GTP binding protein 4).

NR:

description
nucleolar GTP-binding protein 1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU45684 True 277 lncRNA 0.43 3 39812310 39813571

Neighbor


gene id symbol gene type direction distance location
AMCG00019727 larp4b,LOC106599484 coding downstream 72067 39733389 ~ 39740243 (-)
AMCG00019725 NA coding downstream 84020 39710987 ~ 39728290 (-)
AMCG00019721 LOC106599479 coding downstream 442113 39363964 ~ 39370197 (-)
AMCG00019720 NA coding downstream 616477 39195494 ~ 39195833 (-)
AMCG00019719 NA coding downstream 715198 39082102 ~ 39097112 (-)
AMCG00019726 idi1,LOC107713854 coding upstream 12784 39826355 ~ 39830587 (-)
AMCG00019734 NA coding upstream 916122 40729693 ~ 40766188 (-)
AMCG00019738 NA coding upstream 1734347 41547918 ~ 41563384 (-)
AMCG00019739 NA coding upstream 1760705 41574276 ~ 41576305 (-)
AMCG00019743 tmx3,zgc:152808 coding upstream 2575409 42388980 ~ 42406310 (-)
G36534 NA non-coding downstream 102782 39706602 ~ 39709528 (-)
G36495 NA non-coding downstream 431602 39379808 ~ 39380708 (-)
G36470 NA non-coding downstream 518937 39245792 ~ 39293373 (-)
G36456 NA non-coding downstream 730331 39078503 ~ 39081979 (-)
G36386 vps41 non-coding downstream 1192653 38618841 ~ 38619657 (-)
G36557 NA non-coding upstream 84316 39897887 ~ 39901757 (-)
G36576 NA non-coding upstream 376249 40189820 ~ 40191361 (-)
G36582 NA non-coding upstream 521572 40335143 ~ 40335556 (-)
G36590 NA non-coding upstream 590680 40404251 ~ 40404583 (-)
G36605 NA non-coding upstream 832902 40646473 ~ 40646687 (-)
AMCG00019724 dip2c,dip2ca,LOC106522911,LOC106532211 other downstream 306748 39416887 ~ 39505562 (-)
AMCG00019698 NA other downstream 1702086 37889444 ~ 38110224 (-)
AMCG00019665 NA other downstream 3830774 35934796 ~ 35981536 (-)
G35867 NA other downstream 4756866 35055019 ~ 35055444 (-)
AMCG00019645 NA other downstream 5290040 34510733 ~ 34522270 (-)
AMCG00019731 NA other upstream 156604 39970175 ~ 40123987 (-)
AMCG00019741 NA other upstream 2257491 42071062 ~ 42078932 (-)
G36817 NA other upstream 2730545 42544116 ~ 42544524 (-)
G36862 NA other upstream 2830753 42644324 ~ 42656393 (-)
G36982 NA other upstream 3484660 43298231 ~ 43360906 (-)

Expression



Co-expression Network