G36644


Basic Information

Item Value
gene id G36644
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 40871108 ~ 40871315 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU45808
gtactaagtcgaaggggtcaaatacttatttccctcattaacatgcaaatcaatttataacttttttgaaatgcatttttctggattttgttgttgttattctgtctctcactgttaaaatacacctaccattaaaattatagactgatcatttctttgtcagtgggcaaacgtacaaaatcagcaggggatcaaatacttttttccc

Function

GO:

id name namespace
GO:0030168 platelet activation biological_process
GO:0007596 blood coagulation biological_process
GO:0050817 coagulation biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection

RNA

RNA id representative length rna type GC content exon number start site end site
TU45808 True 208 lncRNA 0.33 1 40871108 40871315

Neighbor

gene id symbol gene type direction distance location
AMCG00019732 NA coding upstream 141442 40718483 ~ 40729666 (+)
AMCG00019733 NA coding upstream 168186 40691516 ~ 40702922 (+)
AMCG00019729 NA coding upstream 952087 39913982 ~ 39919021 (+)
AMCG00019730 wdr37,LOC102795438 coding upstream 982085 39855185 ~ 39889023 (+)
AMCG00019728 gtpbp4,LOC107721733 coding upstream 1040277 39812077 ~ 39830831 (+)
AMCG00019737 LOC107674380 coding downstream 433519 41304834 ~ 41312913 (+)
AMCG00019735 cdh7,LOC107584702,LOC108432272 coding downstream 453379 41324694 ~ 41335203 (+)
AMCG00019736 cdh7,LOC108432272,LOC107584702,LOC107729377 coding downstream 477126 41348441 ~ 41358215 (+)
AMCG00019740 NA coding downstream 820256 41691571 ~ 41866477 (+)
AMCG00019742 NA coding downstream 1503153 42374468 ~ 42385648 (+)
G36604 NA non-coding upstream 224421 40646448 ~ 40646687 (+)
G36601 NA non-coding upstream 291013 40579888 ~ 40580095 (+)
G36598 NA non-coding upstream 380993 40489916 ~ 40490115 (+)
G36597 NA non-coding upstream 416624 40454183 ~ 40454484 (+)
G36588 NA non-coding upstream 489684 40381223 ~ 40381424 (+)
G36654 LOC100846954 non-coding downstream 270875 41142190 ~ 41142574 (+)
G36698 NA non-coding downstream 857847 41729162 ~ 41729411 (+)
G36709 NA non-coding downstream 1078810 41950125 ~ 41950350 (+)
G36716 NA non-coding downstream 1161700 42033015 ~ 42033516 (+)
G36720 NA non-coding downstream 1165844 42037159 ~ 42037370 (+)
AMCG00019708 vps41,LOC102790284 other upstream 2238930 38578316 ~ 38632178 (+)
G36212 NA other upstream 3355081 37513987 ~ 37516027 (+)
AMCG00019676 NA other upstream 3657589 37178359 ~ 37213519 (+)
AMCG00019671 adcyap1,paca,LOC106578701 other upstream 4571561 36292346 ~ 36299547 (+)
AMCG00019662 hacd1,LOC105890814,LOC106590135,LOC106578705 other upstream 4807258 36046477 ~ 36063850 (+)
AMCG00019747 tubb6,LOC108431516,LOC100711323,LOC107688430 other downstream 1685225 42556540 ~ 42572080 (+)
AMCG00019751 NA other downstream 1753415 42624730 ~ 42627105 (+)
AMCG00019755 NA other downstream 2089341 42960656 ~ 42962658 (+)
AMCG00019758 NA other downstream 2390579 43261894 ~ 43271192 (+)
G36954 NA other downstream 2458977 43330292 ~ 43333313 (+)

Expression


Co-expression Network