G37456



Basic Information


Item Value
gene id G37456
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 45980733 ~ 45981158 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU46780
taaattgatttgcatgttaatgagggaaataagtatttgaccccttcgacttagtacttggtggcaaaacccttgtttggcaatcacagaggtcagacgtttcttgtagttggccacaaggtttgcacacatctcaggagggattttgtcccactcctctttgcagatcctctccaagtcattaaggtttcaaggctgacgtttggcaactcgaaccttcagctccctccacagattttctatgggattaaggtctggagactggctaggccactccaggaccttaatgtgcttcttcttgagccactcctttgttgccttggctgtgtgttttgggtcagtgtcatgctggaatacccatccacgacccattttcaatgccctggctgaggaaaggaggttctcacccaagatttgacggtacat

Function


GO:

id name namespace
GO:0030168 platelet activation biological_process
GO:0009611 response to wounding biological_process
GO:0007596 blood coagulation biological_process
GO:0007599 hemostasis biological_process
GO:0050817 coagulation biological_process
GO:0042060 wound healing biological_process
GO:0004806 triglyceride lipase activity molecular_function

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection

RNA


RNA id representative length rna type GC content exon number start site end site
TU46780 True 426 lncRNA 0.47 1 45980733 45981158

Neighbor


gene id symbol gene type direction distance location
AMCG00019802 NA coding downstream 701715 45269326 ~ 45279018 (-)
AMCG00019800 fbxl7,LOC107718179,LOC107689422,LOC107589836 coding downstream 947548 45019140 ~ 45033185 (-)
AMCG00019801 cunh7orf25,LOC107722560,LOC105900630 coding downstream 1127883 44852128 ~ 44852850 (-)
AMCG00019789 NA coding downstream 1423320 44555181 ~ 44557413 (-)
AMCG00019788 pip4k2a,LOC106578380 coding downstream 1437753 44517851 ~ 44542980 (-)
AMCG00019805 NA coding upstream 10914 45992072 ~ 46001203 (-)
AMCG00019806 NA coding upstream 125125 46106283 ~ 46133174 (-)
AMCG00019808 NA coding upstream 520689 46501847 ~ 46510145 (-)
AMCG00019807 NA coding upstream 551531 46532689 ~ 46543036 (-)
AMCG00019809 lztfl1 coding upstream 565155 46546313 ~ 46590268 (-)
G37443 NA non-coding downstream 158613 45808851 ~ 45822120 (-)
G37437 NA non-coding downstream 301644 45678890 ~ 45679089 (-)
G37435 NA non-coding downstream 331895 45648401 ~ 45648838 (-)
G37434 NA non-coding downstream 332633 45647557 ~ 45648100 (-)
G37425 NA non-coding downstream 381136 45599034 ~ 45599597 (-)
G37490 LOC107575789,LOC100846954 non-coding upstream 373925 46355083 ~ 46355716 (-)
G37493 NA non-coding upstream 446792 46427950 ~ 46428949 (-)
G37539 NA non-coding upstream 657032 46638190 ~ 46672792 (-)
G37551 NA non-coding upstream 747784 46728942 ~ 46730170 (-)
G37562 LOC100136012 non-coding upstream 809869 46791027 ~ 46791485 (-)
AMCG00019799 NA other downstream 1070583 44896499 ~ 44910150 (-)
AMCG00019768 NA other downstream 2266956 43577309 ~ 43713777 (-)
G36982 NA other downstream 2619827 43298231 ~ 43360906 (-)
AMCG00019761 NA other downstream 2638027 43330289 ~ 43342706 (-)
G36862 NA other downstream 3324340 42644324 ~ 42656393 (-)
G37492 NA other upstream 384180 46365338 ~ 46393098 (-)
AMCG00019824 NA other upstream 1911045 47892203 ~ 47901933 (-)
G37806 LOC100846954,LOC107575789 other upstream 2541510 48522668 ~ 48523702 (-)
AMCG00019865 LOC102778867,LOC107557236 other upstream 4615038 50596196 ~ 50698163 (-)
AMCG00019866 NA other upstream 4724682 50705840 ~ 50712143 (-)

Expression



Co-expression Network