AMCG00019972 (sh3glb2)


Basic Information

Item Value
gene id AMCG00019972
gene name sh3glb2
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 4930503 ~ 4940565 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00019972
AAACCACTAAACCACAGAGCAGCCATCACTTTAACGGATCCGTTTGTCATCCTGCAGTTCACAGAGGAGAAACTGGGCCAGGCCGAGAAGACCGAGTTGGATGCCCACCTTGAGAACTTGCTGGCCCGAGCAGATAGCACCAAGAACTGGACCGAGAAGATCTTCAGGCAGACTGAGGTTCTGCTCCAGCCCAACCCAAGTGCTCGGATTGAGGAGTTCCTGTTTGAGAAGCTGGACAGGAAGCTCCCCTCACGGACCACGAATGGTGAGCTCCTGGGCCAGTATATGCTGGAGGCCGCCAACGACTTTGGACCTGGCAGCCCGTAT

Function

symbol description
sh3glb2 Enables identical protein binding activity. Located in cytosol and nucleoplasm.

NR:

description
PREDICTED: endophilin-B2 isoform X10

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00019972 True 327 mRNA 0.56 2 4930503 4940565

Neighbor

gene id symbol gene type direction distance location
AMCG00019970 NA coding downstream 21948 4898940 ~ 4908555 (-)
AMCG00019968 uck1,LOC102793675 coding downstream 43605 4875586 ~ 4886898 (-)
AMCG00019964 fam78a,LOC106563259 coding downstream 163644 4755524 ~ 4766859 (-)
AMCG00019960 NA coding downstream 302634 4622417 ~ 4627869 (-)
AMCG00019956 fibcd1,LOC105015243,LOC108428067,LOC107574583,LOC107596897 coding downstream 666926 4255272 ~ 4263577 (-)
AMCG00019971 NA coding upstream 28625 4969190 ~ 4983211 (-)
AMCG00019975 NA coding upstream 52071 4992636 ~ 5005983 (-)
AMCG00019974 naif1,LOC107754425,LOC107559603,LOC107560040 coding upstream 125075 5065640 ~ 5069039 (-)
AMCG00019983 NA coding upstream 191481 5132046 ~ 5153053 (-)
AMCG00019982 NA coding upstream 217794 5158359 ~ 5159320 (-)
G59979 prrc2b,LOC107562325 non-coding downstream 81707 4844797 ~ 4848796 (-)
G59963 NA non-coding downstream 130234 4796726 ~ 4800269 (-)
G59958 NA non-coding downstream 175311 4750487 ~ 4755192 (-)
G59941 NA non-coding downstream 256894 4673284 ~ 4673609 (-)
G59940 NA non-coding downstream 258335 4671780 ~ 4672168 (-)
G60034 dpm2,LOC107664400,LOC107681851,LOC107712384 non-coding upstream 45116 4985681 ~ 4989055 (-)
G60089 NA non-coding upstream 177786 5118351 ~ 5160697 (-)
G60088 set,LOC105014167,LOC100696975,LOC102777863,LOC107083999 non-coding upstream 212493 5153058 ~ 5157193 (-)
G60099 NA non-coding upstream 221441 5162006 ~ 5162521 (-)
G60100 NA non-coding upstream 223199 5163764 ~ 5163995 (-)
G59806 NA other downstream 1450394 3479782 ~ 3480109 (-)
AMCG00019942 NA other downstream 1744538 3166237 ~ 3185965 (-)
G59720 NA other downstream 1819156 3107801 ~ 3111347 (-)
G59712 NA other downstream 1896168 3031856 ~ 3034335 (-)
G59545 NA other downstream 2423483 2494899 ~ 2507020 (-)
AMCG00019976 fam102a,LOC105891604,LOC108430372,LOC103389177 other upstream 71879 5012444 ~ 5061512 (-)
G60118 NA other upstream 323349 5263914 ~ 5265925 (-)
AMCG00019993 NA other upstream 336097 5276662 ~ 5278291 (-)
AMCG00019992 NA other upstream 351025 5291590 ~ 5292673 (-)
AMCG00020002 edf1,LOC106563255,LOC105015108,LOC100194632 other upstream 1219012 6159577 ~ 6172474 (-)

Expression


Co-expression Network