AMCG00020039 (ntng2a,LOC103151468,LOC107664998,LOC104943762)


Basic Information

Item Value
gene id AMCG00020039
gene name ntng2a,LOC103151468,LOC107664998,LOC104943762
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 7507361 ~ 7515691 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00020039
ATGCAAGACTGTGAGTGCTATGGCCACTCAAACCGCTGCAGCTATATTGATTTTCTCAACATCGTGACTTGTGTCAGCTGCAAACACAACACTAGGGGGCAGCACTGCCAGCACTGCCGCCTGGGATACTTCCGGAACGCTTCTGCGGAGCTGGATGATGAGAACGTTTGCATAGTGTGTAACTGTAACCTGATGGGCTCCCTGAATGACCGCTGCAATGAGACGGGTTACTGCGAGTGTAAAGACGGTGCATCCGGGCTGAAATGTGAAGACTGTCTGCCCGGATACTACTGGAAGCAGGGCTGTTTCCCCAACGTCTGCGACGACGAGCTTCTGCTCTGCCAAAACGGGGGCACCTGCTACCAGAACCAGAGGTGCCTGTGCCCCCCGGACTTCAAGGGGGTCCTCTGCGAGCAGCCCAAGTGCGCTAACGACAAAGGGGACTGCAACACTGCCTCAACCTCGTACCTCAGCCTCACCCTGCTCCTCCTTTGCACCCTGGGGAGCCAGCTGGCCACGCTCACCGCTTACTGA

Function

symbol description
ntng2a Predicted to be involved in several processes, including basement membrane assembly; cell migration; and substrate adhesion-dependent cell spreading. Predicted to be part of laminin complex. Orthologous to human NTNG2 (netrin G2).

NR:

description
PREDICTED: filaggrin-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00020039 True 534 mRNA 0.57 4 7507361 7515691

Neighbor

gene id symbol gene type direction distance location
AMCG00020033 NA coding downstream 54286 7445481 ~ 7453075 (-)
AMCG00020034 NA coding downstream 62867 7429012 ~ 7444494 (-)
AMCG00020035 NA coding downstream 121599 7364054 ~ 7385762 (-)
AMCG00020027 lhx2,lhx2b coding downstream 380738 7112813 ~ 7126623 (-)
AMCG00020026 NA coding downstream 499305 6986536 ~ 7008056 (-)
AMCG00020038 NA coding upstream 22241 7537932 ~ 7569605 (-)
AMCG00020043 nup188,LOC102792001 coding upstream 251234 7766925 ~ 7785992 (-)
AMCG00020051 NA coding upstream 276607 7792298 ~ 7797939 (-)
AMCG00020050 lrrc8a,LOC104923672 coding upstream 284231 7799922 ~ 7810406 (-)
AMCG00020054 vav2 coding upstream 366129 7881820 ~ 7927867 (-)
G60387 NA non-coding downstream 706611 6797909 ~ 6800750 (-)
G60377 NA non-coding downstream 811585 6679178 ~ 6695776 (-)
G60356 NA non-coding downstream 1017984 6487309 ~ 6489377 (-)
G60345 NA non-coding downstream 1062628 6443275 ~ 6444733 (-)
G60317 NA non-coding downstream 1148422 6300656 ~ 6358939 (-)
G60540 NA non-coding upstream 56906 7572597 ~ 7572831 (-)
G60610 NA non-coding upstream 337310 7853001 ~ 7854373 (-)
G60656 NA non-coding upstream 528918 8044609 ~ 8047241 (-)
G60723 NA non-coding upstream 1278277 8793968 ~ 8796315 (-)
G60725 NA non-coding upstream 1283273 8798964 ~ 8799167 (-)
AMCG00020019 NA other downstream 1035927 6467271 ~ 6471434 (-)
G60348 NA other downstream 1040775 6463548 ~ 6466586 (-)
AMCG00020017 arpc5l,arpc5la,LOC107571143,LOC107753090,LOC108411248 other downstream 1045933 6450622 ~ 6461428 (-)
AMCG00020002 edf1,LOC106563255,LOC105015108,LOC100194632 other downstream 1334887 6159577 ~ 6172474 (-)
AMCG00019992 NA other downstream 2214688 5291590 ~ 5292673 (-)
AMCG00020066 fam69b,fa69b other upstream 1297094 8812785 ~ 8828109 (-)
G60746 NA other upstream 1323520 8839211 ~ 8839945 (-)
G61170 NA other upstream 3239777 10755468 ~ 10756419 (-)
G61269 NA other upstream 4180000 11695691 ~ 11701645 (-)
AMCG00020159 NA other upstream 4486009 12001700 ~ 12052211 (-)

Expression


Co-expression Network