AMCG00020141 (mapkap1)


Basic Information

Item Value
gene id AMCG00020141
gene name mapkap1
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 11144695 ~ 11162222 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00020141
GGCCATGTAGGTACAACAGCAACCAAAAAAATTGAAGTCTACCTCTCGATGCAGTCTGCGCAGGAGAAGCTGCACCCTATGACCGTGGTGACCATGGCCAACGCCAGAGTGCACGACCTCATCGGCCTCATCTGCTGGCAATACACCGGCGAGGGCCGGGAGCCCAAGCTCAATGAAAATGTCAACGCGTACTGCCTTCACATCGCCGAGGATGACGGTGAGGTTGATACGGACTTTCCGCCTCTCGACTCCAACGAACCCATTCACAAGTTTGGCTTCAGCACCCTGGCACTGGTGGAGAAGTACTCCTCGCCCGGGCTGGCAGCAAAACAGTCCCTCTTTGTGCGAATCAATGCTGCCCATGGCTTCTCCCTGATTCCTGTGGACAGTTTGAAAGTGACCATGAAGGAAATCCTGCAGAAAGCGCTTAAGAAGAGGAAAGGATCACAGAAGGGATCAGAAACTTACAGGAATGGGGGGCCTTGCCCAAGCCTATCCTGGGCTGCAGTGGTGGGGGTGCAATGTTCCAGCAAGAACATTGTACGAGAGCAGTGA

Function

symbol description
mapkap1 Predicted to enable phosphatidylinositol-4,5-bisphosphate binding activity. Acts upstream of or within cell migration involved in mesendoderm migration and regulation of cell projection assembly. Predicted to be part of TORC2 complex. Predicted to be active in cytoplasm and plasma membrane. Orthologous to human MAPKAP1 (MAPK associated protein 1).

NR:

description
PREDICTED: target of rapamycin complex 2 subunit MAPKAP1 isoform X2

GO:

id name namespace
GO:0016310 phosphorylation biological_process
GO:0016301 kinase activity molecular_function

KEGG:

id description
K20410 MAPKAP1, SIN1; target of rapamycin complex 2 subunit MAPKAP1

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00020141 True 555 mRNA 0.54 4 11144695 11162222

Neighbor

gene id symbol gene type direction distance location
AMCG00020140 mapkap1 coding downstream 34937 11098474 ~ 11109758 (-)
AMCG00020135 LOC103036375,LOC107681247,LOC108423724,LOC102294584,LOC107560229 coding downstream 200931 10934775 ~ 10943764 (-)
AMCG00020136 NA coding downstream 327770 10783364 ~ 10816925 (-)
AMCG00020133 NA coding downstream 365308 10773696 ~ 10779387 (-)
AMCG00020132 NA coding downstream 417164 10704975 ~ 10727531 (-)
AMCG00020139 mapkap1,LOC107103532 coding upstream 19164 11181386 ~ 11187648 (-)
AMCG00020151 angptl2,LOC106579898,LOC107669255 coding upstream 656503 11818725 ~ 11843715 (-)
AMCG00020155 NA coding upstream 797395 11959617 ~ 11960888 (-)
AMCG00020153 fbxw2,LOC106571134 coding upstream 811401 11973623 ~ 11989110 (-)
AMCG00020162 NA coding upstream 889992 12052214 ~ 12069743 (-)
G61206 NA non-coding downstream 151449 10992899 ~ 10993246 (-)
G61203 NA non-coding downstream 175096 10967180 ~ 10969599 (-)
G61201 NA non-coding downstream 182185 10962311 ~ 10962510 (-)
G61200 NA non-coding downstream 183261 10961136 ~ 10961434 (-)
G61137 NA non-coding downstream 443812 10698129 ~ 10700883 (-)
G61273 NA non-coding upstream 551279 11713501 ~ 11723414 (-)
G61302 NA non-coding upstream 763342 11925564 ~ 11927864 (-)
G61424 NA non-coding upstream 1232063 12394285 ~ 12395028 (-)
G61470 NA non-coding upstream 1268580 12430802 ~ 12451793 (-)
G61477 NA non-coding upstream 1331579 12493801 ~ 12499426 (-)
G61170 NA other downstream 388276 10755468 ~ 10756419 (-)
G60746 NA other downstream 2304750 8839211 ~ 8839945 (-)
AMCG00020066 fam69b,fa69b other downstream 2316586 8812785 ~ 8828109 (-)
G60516 NA other downstream 3582103 7440803 ~ 7562592 (-)
AMCG00020019 NA other downstream 4673261 6467271 ~ 6471434 (-)
G61269 NA other upstream 533469 11695691 ~ 11701645 (-)
AMCG00020159 NA other upstream 839478 12001700 ~ 12052211 (-)
AMCG00020180 tubb2b,tubb4b,tbb2c,LOC103372938,LOC106580001,LOC100136483,LOC105029894,LOC103045037,LOC105891054,LOC105023713,LOC106593669,LOC108260450,LOC108241762,LOC106575097 other upstream 1322147 12484369 ~ 12509937 (-)
G61589 NA other upstream 1835616 12997838 ~ 12998223 (-)
AMCG00020212 NA other upstream 2054774 13216996 ~ 13224512 (-)

Expression


Co-expression Network