AMCG00020292



Basic Information


Item Value
gene id AMCG00020292
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 14989030 ~ 14990430 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00020292
AAGACCATGTCTTTCCCGCAGCTGGGATATCAGTATATCCGCCCCATGTACCCGGCGGAGCGCCCGGGGATCGGCGGTGCCCGCGCCGGGACCGAGCTCAGCCCGTCCGGGGCGCTCTCCAGCGTCCTGTCCACCATGTACGGATCTCCCTTCGCAGCAGCACAGGGATACGGGTGGCCAATATGA

Function


GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0031018 endocrine pancreas development biological_process
GO:0007369 gastrulation biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00020292 True 186 mRNA 0.66 2 14989030 14990430

Neighbor


gene id symbol gene type direction distance location
AMCG00020280 NA coding upstream 527729 14451775 ~ 14461301 (+)
AMCG00020279 amfr,LOC107566269 coding upstream 538379 14439078 ~ 14450651 (+)
AMCG00020276 NA coding upstream 605800 14339835 ~ 14383230 (+)
AMCG00020275 dus2,LOC108229071,LOC106942792 coding upstream 656621 14314392 ~ 14332409 (+)
AMCG00020277 LOC102693979 coding upstream 686031 14294733 ~ 14302999 (+)
AMCG00020291 NA coding downstream 278 14990708 ~ 14991451 (+)
AMCG00020298 NA coding downstream 170167 15160597 ~ 15165994 (+)
AMCG00020296 NA coding downstream 175584 15166014 ~ 15199292 (+)
AMCG00020295 NA coding downstream 221660 15212090 ~ 15218030 (+)
AMCG00020297 aktip,LOC107713059 coding downstream 245253 15235683 ~ 15244984 (+)
G62108 NA non-coding upstream 367330 14554856 ~ 14621700 (+)
G62118 NA non-coding upstream 410328 14577507 ~ 14578702 (+)
G62114 NA non-coding upstream 421592 14566719 ~ 14567438 (+)
G62062 NA non-coding upstream 587728 14345296 ~ 14401302 (+)
G62039 NA non-coding upstream 700196 14241865 ~ 14288834 (+)
G62185 NA non-coding downstream 41612 15032042 ~ 15034083 (+)
G62251 chd9,LOC106562403 non-coding downstream 307317 15297747 ~ 15298181 (+)
G62275 NA non-coding downstream 343254 15333684 ~ 15335056 (+)
G62282 LOC107575789 non-coding downstream 432777 15423207 ~ 15423573 (+)
G62368 NA non-coding downstream 1073665 16064095 ~ 16066816 (+)
AMCG00020281 slc12a4 other upstream 516485 14467800 ~ 14472545 (+)
AMCG00020273 NA other upstream 756762 14195784 ~ 14232268 (+)
AMCG00020267 NA other upstream 1037983 13948426 ~ 13951047 (+)
AMCG00020241 cdc26,LOC107743800,LOC107691734,LOC107603191 other upstream 1103914 13882825 ~ 13885116 (+)
AMCG00020255 NA other upstream 1116385 13863477 ~ 13872645 (+)
AMCG00020331 st3gal2,LOC107686287,LOC106573711,LOC107672232 other downstream 1592456 16582886 ~ 16604658 (+)
G62632 NA other downstream 1823944 16814374 ~ 16815857 (+)
AMCG00020370 NA other downstream 2443212 17433642 ~ 17442711 (+)
AMCG00020371 nutf2 other downstream 2468714 17459144 ~ 17471869 (+)
G62895 NA other downstream 2937898 17928328 ~ 17928904 (+)

Expression



Co-expression Network