AMCG00020344


Basic Information

Item Value
gene id AMCG00020344
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 16848880 ~ 16849657 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00020344
ATGATCCTCAACGGCGTGTGTGTGATCTGGAGGGGCTGGATCGACCTGCAGAGACTGGACGGCATGGGCTGCTTGGAGTATGATGAGGAGAGAGCTCAGCAGGAGGATGCCCTGGCGCAGCAGGCCTTCGAAGAGGCGCGGAGGAGGACA

Function

GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00020344 True 150 mRNA 0.61 2 16848880 16849657

Neighbor

gene id symbol gene type direction distance location
AMCG00020342 clg19h16orf70,LOC106573725,LOC106560845,LOC105892482,LOC103042166 coding downstream 7370 16828951 ~ 16841510 (-)
AMCG00020347 NA coding downstream 57598 16779003 ~ 16791282 (-)
AMCG00020348 NA coding downstream 70258 16770322 ~ 16778622 (-)
AMCG00020345 NA coding downstream 79920 16762077 ~ 16768960 (-)
AMCG00020339 NA coding downstream 91511 16726578 ~ 16757369 (-)
AMCG00020343 cbfb,LOC107715607 coding upstream 17575 16867232 ~ 16870178 (-)
AMCG00020357 NA coding upstream 145228 16994885 ~ 17000013 (-)
AMCG00020356 NA coding upstream 172195 17021852 ~ 17026667 (-)
AMCG00020355 nudt21,LOC107660760,LOC107690386,LOC107721012 coding upstream 178430 17028087 ~ 17032112 (-)
AMCG00020354 NA coding upstream 199693 17049350 ~ 17057242 (-)
G62582 NA non-coding downstream 168256 16679856 ~ 16680624 (-)
G62580 NA non-coding downstream 179369 16668897 ~ 16669511 (-)
G62475 NA non-coding downstream 367890 16480530 ~ 16480990 (-)
G62283 LOC107575789 non-coding downstream 1425306 15423155 ~ 15423574 (-)
G62191 NA non-coding downstream 1814804 15032135 ~ 15034076 (-)
G62655 gnao1a,gnao1,LOC108264367,LOC108249535,LOC106925363,LOC103367675 non-coding upstream 47213 16896870 ~ 16923733 (-)
G62659 NA non-coding upstream 137662 16987319 ~ 16989284 (-)
G62660 NA non-coding upstream 140610 16990267 ~ 16990714 (-)
G62675 NA non-coding upstream 169133 17018790 ~ 17019552 (-)
G62715 NA non-coding upstream 270497 17120154 ~ 17175835 (-)
AMCG00020346 nup93,LOC103368977 other downstream 31113 16794996 ~ 16817767 (-)
G62618 NA other downstream 55713 16792866 ~ 16793167 (-)
AMCG00020336 NA other downstream 223910 16616323 ~ 16624970 (-)
G62421 LOC103138816,LOC103466733,LOC108251456 other downstream 573307 16272451 ~ 16275573 (-)
G62415 NA other downstream 593761 16252788 ~ 16255119 (-)
G62853 necab2 other upstream 761007 17610664 ~ 17626189 (-)
AMCG00020403 NA other upstream 1137524 17987181 ~ 18015862 (-)
G62961 NA other upstream 1156511 18006168 ~ 18039960 (-)
AMCG00020446 cssa11h16orf87,cunh16orf87,clg02h16orf87,zgc:92818,LOC106587296,LOC103043940,LOC107757775 other upstream 3438913 20288570 ~ 20299843 (-)
G63464 NA other upstream 4462545 21312202 ~ 21312605 (-)

Expression


Co-expression Network