AMCG00020411



Basic Information


Item Value
gene id AMCG00020411
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 18089099 ~ 18092504 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00020411
ATGCCCTATGTGCAAGCTGTGATCCATGAAGTGCAGCGCTATGGAAGTGTCCTCCCTCTCAGTGTCTTCCACGCCACCACTCAGGACATACAGGTGCTGGGCTACAGCATTCCAAAGGTAAAGTCCCCTCAAGGCCCACGGATGTGTCTGGGTGAGGGGATGGTGCGCATGGGGCTGTTCTTGTTCTTCGTGACGCTGCTGCACCGCTTCCAGTTCCACTTACCCCAGGACGGCGGGGAGCCTGACCTCACGCCTAACTTCGGAATCACCCAGGGACCCAAACCCTACCAACTGGGAGTGAGGCTCAGAGGACAACAGTGTGGGTGA

Function


GO: NA

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00020411 True 327 mRNA 0.58 2 18089099 18092504

Neighbor


gene id symbol gene type direction distance location
AMCG00020404 NA coding downstream 9948 18071296 ~ 18079151 (-)
AMCG00020401 NA coding downstream 33170 18050833 ~ 18055929 (-)
AMCG00020402 NA coding downstream 49113 18029373 ~ 18039986 (-)
AMCG00020400 NA coding downstream 104458 17981395 ~ 17984641 (-)
AMCG00020398 NA coding downstream 133173 17950334 ~ 17955926 (-)
AMCG00020410 NA coding upstream 11684 18104188 ~ 18110182 (-)
AMCG00020409 NA coding upstream 79116 18171620 ~ 18175979 (-)
AMCG00020414 NA coding upstream 103236 18195740 ~ 18225630 (-)
AMCG00020417 NA coding upstream 143135 18235639 ~ 18247655 (-)
AMCG00020418 NA coding upstream 155153 18247657 ~ 18291605 (-)
G62951 cnot1 non-coding downstream 119408 17968233 ~ 17969691 (-)
G62880 NA non-coding downstream 237986 17848158 ~ 17851113 (-)
G62770 pard6a,LOC108250860,LOC106523998,LOC107101591 non-coding downstream 718653 17364823 ~ 17370446 (-)
G62715 NA non-coding downstream 913264 17120154 ~ 17175835 (-)
G62675 NA non-coding downstream 1069547 17018790 ~ 17019552 (-)
G62981 NA non-coding upstream 44976 18137480 ~ 18138298 (-)
G63015 NA non-coding upstream 91504 18184008 ~ 18186050 (-)
G63057 NA non-coding upstream 265321 18357825 ~ 18358910 (-)
G63092 NA non-coding upstream 304963 18397467 ~ 18398731 (-)
G63096 NA non-coding upstream 344021 18436525 ~ 18436939 (-)
G62961 NA other downstream 49139 18006168 ~ 18039960 (-)
AMCG00020403 NA other downstream 73237 17987181 ~ 18015862 (-)
G62853 necab2 other downstream 462910 17610664 ~ 17626189 (-)
AMCG00020346 nup93,LOC103368977 other downstream 1271332 16794996 ~ 16817767 (-)
G62618 NA other downstream 1295932 16792866 ~ 16793167 (-)
AMCG00020446 cssa11h16orf87,cunh16orf87,clg02h16orf87,zgc:92818,LOC106587296,LOC103043940,LOC107757775 other upstream 2196066 20288570 ~ 20299843 (-)
G63464 NA other upstream 3219698 21312202 ~ 21312605 (-)
AMCG00020471 NA other upstream 4038338 22130842 ~ 22132737 (-)
AMCG00020489 rnf166,LOC106587267,LOC106562062,LOC107685853 other upstream 4348288 22440792 ~ 22466767 (-)
G63679 NA other upstream 4451338 22543842 ~ 22544689 (-)

Expression



Co-expression Network