AMCG00020545 (zcchc14)


Basic Information

Item Value
gene id AMCG00020545
gene name zcchc14
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 24401170 ~ 24401799 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00020545
ATGGTGGAGAAGCGCAGTTTGGTCCAAAGGGAAGGGGTCTATCGCTGGTTTTCGGAGTTAAATTCGGCGCAGAGGGTCGAGTTCCTGTGCGGGCTGCTGGACCTGTGTGTGCCGATTGAACTGCGGTTCCTGGGCTCTTGTCTGGAGGATCTGGCCAGGAAGGACTACCACTCGCTGCGAGACGCGGAGATAAAAGCCAACAATCCCGCCGACCTGGCCCATCTGACCAACATCACGGACGAGGTGGTGCGGAGCAAGCTGCTGATCTCCCTGGCGCTGCTCAACTCCGACAACCGGGAGGCAGCCGGGGAGCTGTTCAGGACCCTCACGCACATCGATTCAATCATCAACAACTACGGGCTGCAGCTCAACGACGGCCAGACCGGAGATCAGTTTTTACTGCTCTTCACCATGGCCTCCAACCACCCGGCTTTCAGCTTCCACCAGAAGCAAGTGCTGAGACAGGAGCTGACCCAGATCCAGACTATTGTCAACACCACCTGTAATAATGCCAGCCTTACTACGGCTAACACGGTCACCACGTTCACCACCACGACGACTTTCAGCTCGTGTATCATGGGCTGTCATTGCTGCCACAAGGTGGGTTTAAAGAAGCACCCTCGTCTTTAA

Function

symbol description
zcchc14 Predicted to enable nucleic acid binding activity; phosphatidylinositol binding activity; and zinc ion binding activity. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human ZCCHC14 (zinc finger CCHC-type containing 14).

NR:

description
PREDICTED: zinc finger CCHC domain-containing protein 14

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00020545 True 630 mRNA 0.56 1 24401170 24401799

Neighbor

gene id symbol gene type direction distance location
AMCG00020544 NA coding downstream 31127 24351481 ~ 24370043 (-)
AMCG00020538 NA coding downstream 72347 24308242 ~ 24328823 (-)
AMCG00020542 NA coding downstream 158527 24236128 ~ 24242643 (-)
AMCG00020541 NA coding downstream 204210 24164670 ~ 24196960 (-)
AMCG00020539 NA coding downstream 280432 24091734 ~ 24120738 (-)
AMCG00020546 NA coding upstream 76702 24478501 ~ 24508437 (-)
AMCG00020550 slc7a5,LOC107583127,LOC107701543,LOC107707523 coding upstream 124303 24526102 ~ 24531462 (-)
AMCG00020549 slc7a5,LOC107707523,LOC107583127,LOC107654150,LOC107581836,LOC107714008 coding upstream 144137 24545936 ~ 24553994 (-)
AMCG00020547 ca5a,LOC102795873 coding upstream 155814 24557613 ~ 24576901 (-)
AMCG00020548 sae2,uba2,LOC107583129,LOC106560931,LOC107707412 coding upstream 176583 24578382 ~ 24586519 (-)
G64028 NA non-coding downstream 96235 24304484 ~ 24304935 (-)
G64013 NA non-coding downstream 166043 24233642 ~ 24235127 (-)
G64012 NA non-coding downstream 167772 24232716 ~ 24233398 (-)
G63921 NA non-coding downstream 487949 23912862 ~ 23913221 (-)
G63858 NA non-coding downstream 1122097 23278792 ~ 23279073 (-)
G64120 NA non-coding upstream 283725 24685524 ~ 24687760 (-)
G64126 NA non-coding upstream 299334 24701133 ~ 24701336 (-)
G64170 NA non-coding upstream 453137 24854936 ~ 24856624 (-)
G64186 NA non-coding upstream 543499 24945298 ~ 24946210 (-)
G64213 NA non-coding upstream 599548 25001347 ~ 25001657 (-)
G63819 NA other downstream 1239270 23154692 ~ 23161900 (-)
G63679 NA other downstream 1856481 22543842 ~ 22544689 (-)
AMCG00020489 rnf166,LOC106587267,LOC106562062,LOC107685853 other downstream 1934403 22440792 ~ 22466767 (-)
AMCG00020471 NA other downstream 2268433 22130842 ~ 22132737 (-)
G63464 NA other downstream 3088565 21312202 ~ 21312605 (-)
AMCG00020561 NA other upstream 246204 24648003 ~ 24677810 (-)
AMCG00020559 NA other upstream 290094 24691893 ~ 24698947 (-)
AMCG00020560 NA other upstream 352083 24753882 ~ 24776409 (-)
AMCG00020581 NA other upstream 709311 25111110 ~ 25119596 (-)
G64247 NA other upstream 719299 25121098 ~ 25139385 (-)

Expression


Co-expression Network