AMCG00020566 (znrf1,LOC106573647)


Basic Information

Item Value
gene id AMCG00020566
gene name znrf1,LOC106573647
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 24843010 ~ 24846428 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00020566
ATGGGGGGCAAGCAGAGCACGGCGGGGCGGCCCCGAGGAGCTTTTCCCGGTGTCTCGACGGATGACAGCGCGGTGCCACCTGCGGCCCACTTCGGGCACTACCGGGCTGGCGGGGCGATGGGGTTGCGCAGCCGGTCGGTCAGCTCGGTTGCCGGGATGGGAATGGACCCCAGCGGCGCGGTGCCTTTCGGATTTTATGCCGGCCGAGGAGCTGGGGACACTGATAGAGCCGGGGGGGGCTCGGGTGCGGACACAGCCCATGGGCACGGCTACCAGGAAACGGGCGGTGGGCATCACACGGACGGTATGCTTTATCTGGGATCCCGAGGGTCGCTGGCGGACGCGCTGCCTCTCCACATTGCGCCCAGGTGGTTCAGTGCGCACAGCGATTGA

Function

symbol description
znrf1 Predicted to enable ubiquitin-protein transferase activity. Predicted to be involved in proteasome-mediated ubiquitin-dependent protein catabolic process and protein K48-linked ubiquitination. Predicted to act upstream of or within protein phosphopantetheinylation and protein ubiquitination. Predicted to be located in endosome; lysosome; and membrane. Is expressed in nervous system; neural tube; and pectoral fin. Orthologous to human ZNRF1 (zinc and ring finger 1).

NR:

description
PREDICTED: E3 ubiquitin-protein ligase ZNRF1

GO:

id name namespace
GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process biological_process
GO:0070936 protein K48-linked ubiquitination biological_process
GO:0005764 lysosome cellular_component
GO:0005768 endosome cellular_component
GO:0016020 membrane cellular_component
GO:0004842 ubiquitin-protein transferase activity molecular_function
GO:0008270 zinc ion binding molecular_function

KEGG:

id description
K10694 ZNRF1_2; E3 ubiquitin-protein ligase ZNRF1/2

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00020566 True 393 mRNA 0.68 2 24843010 24846428

Neighbor

gene id symbol gene type direction distance location
AMCG00020564 NA coding downstream 21949 24814766 ~ 24821061 (-)
AMCG00020565 NA coding downstream 42227 24791942 ~ 24800783 (-)
AMCG00020554 NA coding downstream 206659 24631379 ~ 24636351 (-)
AMCG00020555 NA coding downstream 232937 24596511 ~ 24610073 (-)
AMCG00020548 sae2,uba2,LOC107583129,LOC106560931,LOC107707412 coding downstream 256491 24578382 ~ 24586519 (-)
AMCG00020575 NA coding upstream 100793 24947221 ~ 24950873 (-)
AMCG00020574 NA coding upstream 126321 24972749 ~ 25001128 (-)
AMCG00020592 polr2c coding upstream 479365 25325793 ~ 25329845 (-)
AMCG00020591 LOC102778684,LOC107573013 coding upstream 484645 25331073 ~ 25348318 (-)
AMCG00020594 gabarapl2,LOC107560072 coding upstream 626827 25473255 ~ 25479762 (-)
G64126 NA non-coding downstream 141674 24701133 ~ 24701336 (-)
G64120 NA non-coding downstream 155250 24685524 ~ 24687760 (-)
G64028 NA non-coding downstream 538075 24304484 ~ 24304935 (-)
G64013 NA non-coding downstream 607883 24233642 ~ 24235127 (-)
G64012 NA non-coding downstream 609612 24232716 ~ 24233398 (-)
G64170 NA non-coding upstream 8508 24854936 ~ 24856624 (-)
G64186 NA non-coding upstream 98870 24945298 ~ 24946210 (-)
G64213 NA non-coding upstream 154919 25001347 ~ 25001657 (-)
G64218 NA non-coding upstream 205776 25052204 ~ 25052452 (-)
G64221 NA non-coding upstream 217708 25064136 ~ 25064342 (-)
AMCG00020560 NA other downstream 66601 24753882 ~ 24776409 (-)
AMCG00020559 NA other downstream 144063 24691893 ~ 24698947 (-)
AMCG00020561 NA other downstream 165200 24648003 ~ 24677810 (-)
G63819 NA other downstream 1681110 23154692 ~ 23161900 (-)
G63679 NA other downstream 2298321 22543842 ~ 22544689 (-)
AMCG00020581 NA other upstream 264682 25111110 ~ 25119596 (-)
G64247 NA other upstream 274670 25121098 ~ 25139385 (-)
G64260 NA other upstream 362631 25209059 ~ 25211063 (-)
G64271 NA other upstream 395741 25242169 ~ 25242511 (-)
AMCG00020589 NA other upstream 426165 25272593 ~ 25284209 (-)

Expression


Co-expression Network